Human CXCR4/CD184/D2S201E ORF/cDNA clone-Lentivirus particle (NM_003467)

Cat. No.: vGMLV000695

Pre-made Human CXCR4/CD184/D2S201E Lentiviral expression plasmid for CXCR4 lentivirus packaging, CXCR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CXCR4/CD184 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000695 Human CXCR4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000695
Gene Name CXCR4
Accession Number NM_003467
Gene ID 7852
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1059 bp
Gene Alias CD184,D2S201E,FB22,HM89,HSY3RR,LAP-3,LAP3,LCR1,LESTR,NPY3R,NPYR,NPYRL,NPYY3R,WHIM,WHIMS
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGGGATCAGTATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGGACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATCTTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGATGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATCAAGCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGTCTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTCTGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGAGTCTGAGTCTTCAAGTTTTCACTCCAGCTAA
ORF Protein Sequence MEGISIYTSDNYTEEMGSGDYDSMKEPCFREENANFNKIFLPTIYSIIFLTGIVGNGLVILVMGYQKKLRSMTDKYRLHLSVADLLFVITLPFWAVDAVANWYFGNFLCKAVHVIYTVNLYSSVLILAFISLDRYLAIVHATNSQRPRKLLAEKVVYVGVWIPALLLTIPDFIFANVSEADDRYICDRFYPNDLWVVVFQFQHIMVGLILPGIVILSCYCIIISKLSHSKGHQKRKALKTTVILILAFFACWLPYYIGISIDSFILLEIIKQGCEFENTVHKWISITEALAFFHCCLNPILYAFLGAKFKTSAQHALTSVSRGSSLKILSKGKRGGHSSVSTESESSSFHSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-600 Pre-Made Ulocuplumab biosimilar, Whole mAb, Anti-CXCR4 Antibody: Anti-FB22/HM89/LAP3/LCR1/NPYR/WHIM/CD184/LAP-3/LESTR/NPY3R/NPYRL/WHIMS/HSY3RR/NPYY3R/WHIMS1/D2S201E therapeutic antibody
    Target Antibody GM-Tg-g-T96079-Ab Anti-CXCR4/ CD184/ D2S201E monoclonal antibody
    Target Antigen GM-Tg-g-T96079-Ag CXCR4 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T96079 chemokine (C-X-C motif) receptor 4 (CXCR4) protein & antibody
    ORF Viral Vector pGMLP000599 Human CXCR4 Lentivirus plasmid
    ORF Viral Vector pGMLP003262 Human CXCR4 Lentivirus plasmid
    ORF Viral Vector pGMLV000634 Human CXCR4 Lentivirus plasmid
    ORF Viral Vector pGMLV000695 Human CXCR4 Lentivirus plasmid
    ORF Viral Vector pGMLV001389 Human CXCR4 Lentivirus plasmid
    ORF Viral Vector pGMPC000631 Human CXCR4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001085 Human CXCR4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000599 Human CXCR4 Lentivirus particle
    ORF Viral Vector vGMLP003262 Human CXCR4 Lentivirus particle
    ORF Viral Vector vGMLV000634 Human CXCR4 Lentivirus particle
    ORF Viral Vector vGMLV000695 Human CXCR4 Lentivirus particle
    ORF Viral Vector vGMLV001389 Human CXCR4 Lentivirus particle


    Target information

    Target ID GM-T96079
    Target Name CXCR4
    Gene ID 7852, 12767, 707329, 60628, 493676, 119863891, 281736, 100050974
    Gene Symbol and Synonyms b2b220Clo,CD184,Cmkar4,CXC-R4,CXCR-4,CXCR4,D2S201E,FB22,HM89,HSY3RR,LAP-3,LAP3,LCR1,LESTR,LOC119863891,NPY3R,NPYR,NPYRL,NPYY3R,PB-CKR,PBSF/SDF-1,Sdf1r,WHIM,WHIMS,WHIMS1
    Uniprot Accession P61073
    Uniprot Entry Name CXCR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000121966
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.