Human KRAS/C-K-RAS/c-Ki-ras2 ORF/cDNA clone-Lentivirus particle (NM_004985.4)

SKU: vGMLP005774
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KRAS/C-K-RAS/c-Ki-ras2 Lentiviral expression plasmid for KRAS lentivirus packaging, KRAS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to KRAS G12C/KRAS/C-K-RAS products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005774 Human KRAS Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005774
Gene Name KRAS
Accession Number NM_004985.4
Gene ID 3845
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 567 bp
Gene Alias C-K-RAS,c-Ki-ras2,CFC2,K-Ras,K-RAS2A,K-RAS2B,K-RAS4A,K-RAS4B,KI-RAS,KRAS1,KRAS2,NS,NS3,RALD,RASK2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59480-Ab Anti-KRAS G12C monoclonal antibody
    Target Antigen GM-Tg-g-T59480-Ag KRAS G12C/KRAS protein
    ORF Viral Vector pGMLP001359 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP001960 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005588 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005740 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005741 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005742 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005743 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005744 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005745 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005746 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005747 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005748 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005749 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005750 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005751 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005752 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005753 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005754 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005755 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005756 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005757 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005758 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005759 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005760 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005761 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005762 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005763 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005764 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005765 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005766 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005767 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005768 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005769 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005770 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005771 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005772 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005773 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005774 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005775 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005776 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005777 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005778 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005779 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005780 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005781 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005782 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP005807 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-051 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-191 Human KRAS Adenovirus plasmid
    ORF Viral Vector pGMPC000180 Human Kras Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000746 Human KRAS Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001359 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP001960 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005588 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005740 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005741 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005742 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005743 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005744 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005745 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005746 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005747 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005748 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005749 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005750 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005751 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005752 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005753 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005754 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005755 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005756 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005757 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005758 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005759 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005760 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005761 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005762 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005763 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005764 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005765 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005766 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005767 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005768 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005769 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005770 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005771 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005772 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005773 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005774 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005775 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005776 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005777 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005778 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005779 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005780 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005781 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005782 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP005807 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP-SPh-051 Human KRAS Lentivirus particle
    ORF Viral Vector vGMAP-SPh-191 Human KRAS Adenovirus particle


    Target information

    Target ID GM-T59480
    Target Name KRAS G12C
    Gene ID 3845, 16653, 707977, 24525, 751104, 403871, 541140, 100064473
    Gene Symbol and Synonyms 'C-K-RAS,C-K-RAS,c-Ki-ras,c-Ki-ras2,CFC2,K-Ras,K-Ras 2,K-RAS2A,K-RAS2B,K-RAS4A,K-RAS4B,KI-RAS,KRAS,Kras-2,KRAS1,KRAS2,NS,NS3,OES,p21,p21B,p21ras,RALD,ras,RASK2
    Uniprot Accession P01116
    Uniprot Entry Name RASK_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Non-Small Cell Lung Cancer, Colorectal Cancer, Pancreas Cancer
    Gene Ensembl ENSG00000133703
    Target Classification Checkpoint-Immuno Oncology

    This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.