Human KRAS/C-K-RAS/c-Ki-ras2 ORF/cDNA clone-Lentivirus particle (NM_004985.4)
SKU: vGMLP005769
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human KRAS/C-K-RAS/c-Ki-ras2 Lentiviral expression plasmid for KRAS lentivirus packaging, KRAS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
KRAS G12C/KRAS/C-K-RAS products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005769 | Human KRAS Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005769 |
Gene Name | KRAS |
Accession Number | NM_004985.4 |
Gene ID | 3845 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 567 bp |
Gene Alias | C-K-RAS,c-Ki-ras2,CFC2,K-Ras,K-RAS2A,K-RAS2B,K-RAS4A,K-RAS4B,KI-RAS,KRAS1,KRAS2,NS,NS3,RALD,RASK2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59480-Ab | Anti-KRAS G12C monoclonal antibody |
Target Antigen | GM-Tg-g-T59480-Ag | KRAS G12C/KRAS protein |
ORF Viral Vector | pGMLP001359 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP001960 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005588 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005740 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005741 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005742 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005743 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005744 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005745 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005746 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005747 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005748 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005749 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005750 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005751 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005752 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005753 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005754 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005755 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005756 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005757 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005758 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005759 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005760 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005761 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005762 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005763 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005764 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005765 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005766 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005767 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005768 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005769 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005770 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005771 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005772 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005773 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005774 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005775 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005776 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005777 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005778 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005779 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005780 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005781 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005782 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP005807 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-051 | Human KRAS Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-191 | Human KRAS Adenovirus plasmid |
ORF Viral Vector | pGMPC000180 | Human Kras Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000746 | Human KRAS Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP001359 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP001960 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005588 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005740 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005741 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005742 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005743 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005744 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005745 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005746 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005747 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005748 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005749 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005750 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005751 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005752 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005753 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005754 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005755 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005756 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005757 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005758 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005759 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005760 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005761 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005762 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005763 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005764 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005765 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005766 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005767 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005768 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005769 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005770 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005771 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005772 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005773 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005774 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005775 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005776 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005777 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005778 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005779 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005780 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005781 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005782 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP005807 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-051 | Human KRAS Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-191 | Human KRAS Adenovirus particle |
Target information
Target ID | GM-T59480 |
Target Name | KRAS G12C |
Gene ID | 3845, 16653, 707977, 24525, 751104, 403871, 541140, 100064473 |
Gene Symbol and Synonyms | 'C-K-RAS,C-K-RAS,c-Ki-ras,c-Ki-ras2,CFC2,K-Ras,K-Ras 2,K-RAS2A,K-RAS2B,K-RAS4A,K-RAS4B,KI-RAS,KRAS,Kras-2,KRAS1,KRAS2,NS,NS3,OES,p21,p21B,p21ras,RALD,ras,RASK2 |
Uniprot Accession | P01116 |
Uniprot Entry Name | RASK_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Non-Small Cell Lung Cancer, Colorectal Cancer, Pancreas Cancer |
Gene Ensembl | ENSG00000133703 |
Target Classification | Checkpoint-Immuno Oncology |
This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.