Human WNT10B/SHFM6/STHAG8 ORF/cDNA clone-Lentivirus particle (NM_003394.3)
Cat. No.: vGMLP005563
Pre-made Human WNT10B/SHFM6/STHAG8 Lentiviral expression plasmid for WNT10B lentivirus packaging, WNT10B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
WNT10B/SHFM6 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005563 | Human WNT10B Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005563 |
Gene Name | WNT10B |
Accession Number | NM_003394.3 |
Gene ID | 7480 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1170 bp |
Gene Alias | SHFM6,STHAG8,WNT-12 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGGAGGAGCCCCGGCCGCGGCCTCCGCCCTCGGGCCTCGCGGGTCTCCTGTTCCTGGCGTTGTGCAGTCGGGCTCTAAGCAATGAGATTCTGGGCCTGAAGTTGCCTGGCGAGCCGCCGCTGACGGCCAACACCGTGTGCTTGACGCTGTCCGGCCTGAGCAAGCGGCAGCTAGGCCTGTGCCTGCGCAACCCCGACGTGACGGCGTCCGCGCTTCAGGGTCTGCACATCGCGGTCCACGAGTGTCAGCACCAGCTGCGCGACCAGCGCTGGAACTGCTCCGCGCTTGAGGGCGGCGGCCGCCTGCCGCACCACAGCGCCATCCTCAAGCGCGGTTTCCGAGAAAGTGCTTTTTCCTTCTCCATGCTGGCTGCTGGGGTCATGCACGCAGTAGCCACGGCCTGCAGCCTGGGCAAGCTGGTGAGCTGTGGCTGTGGCTGGAAGGGCAGTGGTGAGCAGGATCGGCTGAGGGCCAAACTGCTGCAGCTGCAGGCACTGTCCCGAGGCAAGAGTTTCCCCCACTCTCTGCCCAGCCCTGGCCCTGGCTCAAGCCCCAGCCCTGGCCCCCAGGACACATGGGAATGGGGTGGCTGTAACCATGACATGGACTTTGGAGAGAAGTTCTCTCGGGATTTCTTGGATTCCAGGGAAGCTCCCCGGGACATCCAGGCACGAATGCGAATCCACAACAACAGGGTGGGGCGCCAGGTGGTAACTGAAAACCTGAAGCGGAAATGCAAGTGTCATGGCACATCAGGCAGCTGCCAGTTCAAGACATGCTGGAGGGCGGCCCCAGAGTTCCGGGCAGTGGGGGCGGCGTTGAGGGAGCGGCTGGGCCGGGCCATCTTCATTGATACCCACAACCGCAATTCTGGAGCCTTCCAGCCCCGTCTGCGTCCCCGTCGCCTCTCAGGAGAGCTGGTCTACTTTGAGAAGTCTCCTGACTTCTGTGAGCGAGACCCCACTATGGGCTCCCCAGGGACAAGGGGCCGGGCCTGCAACAAGACCAGCCGCCTGTTGGATGGCTGTGGCAGCCTGTGCTGTGGCCGTGGGCACAACGTGCTCCGGCAGACACGAGTTGAGCGCTGCCATTGCCGCTTCCACTGGTGCTGCTATGTGCTGTGTGATGAGTGCAAGGTTACAGAGTGGGTGAATGTGTGTAAGTGA |
ORF Protein Sequence | MLEEPRPRPPPSGLAGLLFLALCSRALSNEILGLKLPGEPPLTANTVCLTLSGLSKRQLGLCLRNPDVTASALQGLHIAVHECQHQLRDQRWNCSALEGGGRLPHHSAILKRGFRESAFSFSMLAAGVMHAVATACSLGKLVSCGCGWKGSGEQDRLRAKLLQLQALSRGKSFPHSLPSPGPGSSPSPGPQDTWEWGGCNHDMDFGEKFSRDFLDSREAPRDIQARMRIHNNRVGRQVVTENLKRKCKCHGTSGSCQFKTCWRAAPEFRAVGAALRERLGRAIFIDTHNRNSGAFQPRLRPRRLSGELVYFEKSPDFCERDPTMGSPGTRGRACNKTSRLLDGCGSLCCGRGHNVLRQTRVERCHCRFHWCCYVLCDECKVTEWVNVCK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1382-Ab | Anti-WN10B/ WNT10B/ SHFM6 functional antibody |
Target Antigen | GM-Tg-g-SE1382-Ag | WNT10B protein |
Cytokine | cks-Tg-g-GM-SE1382 | wingless-type MMTV integration site family, member 10B (WNT10B) protein & antibody |
ORF Viral Vector | pGMLP003631 | Human WNT10B Lentivirus plasmid |
ORF Viral Vector | pGMLP005563 | Human WNT10B Lentivirus plasmid |
ORF Viral Vector | pGMLP005576 | Human WNT10B Lentivirus plasmid |
ORF Viral Vector | vGMLP003631 | Human WNT10B Lentivirus particle |
ORF Viral Vector | vGMLP005563 | Human WNT10B Lentivirus particle |
ORF Viral Vector | vGMLP005576 | Human WNT10B Lentivirus particle |
Target information
Target ID | GM-SE1382 |
Target Name | WNT10B |
Gene ID | 7480, 22410, 708906, 315294, 101093948, 486561, 539337, 100051649 |
Gene Symbol and Synonyms | SHFM6,STHAG8,WNT-12,WNT10B,Wnt12 |
Uniprot Accession | O00744 |
Uniprot Entry Name | WN10B_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000169884 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.