Human WNT10B/SHFM6/STHAG8 ORF/cDNA clone-Lentivirus plasmid (NM_003394.3)

Cat. No.: pGMLP005576
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT10B/SHFM6/STHAG8 Lentiviral expression plasmid for WNT10B lentivirus packaging, WNT10B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to WNT10B/SHFM6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $627.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005576
Gene Name WNT10B
Accession Number NM_003394.3
Gene ID 7480
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1170 bp
Gene Alias SHFM6,STHAG8,WNT-12
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGAGGAGCCCCGGCCGCGGCCTCCGCCCTCGGGCCTCGCGGGTCTCCTGTTCCTGGCGTTGTGCAGTCGGGCTCTAAGCAATGAGATTCTGGGCCTGAAGTTGCCTGGCGAGCCGCCGCTGACGGCCAACACCGTGTGCTTGACGCTGTCCGGCCTGAGCAAGCGGCAGCTAGGCCTGTGCCTGCGCAACCCCGACGTGACGGCGTCCGCGCTTCAGGGTCTGCACATCGCGGTCCACGAGTGTCAGCACCAGCTGCGCGACCAGCGCTGGAACTGCTCCGCGCTTGAGGGCGGCGGCCGCCTGCCGCACCACAGCGCCATCCTCAAGCGCGGTTTCCGAGAAAGTGCTTTTTCCTTCTCCATGCTGGCTGCTGGGGTCATGCACGCAGTAGCCACGGCCTGCAGCCTGGGCAAGCTGGTGAGCTGTGGCTGTGGCTGGAAGGGCAGTGGTGAGCAGGATCGGCTGAGGGCCAAACTGCTGCAGCTGCAGGCACTGTCCCGAGGCAAGAGTTTCCCCCACTCTCTGCCCAGCCCTGGCCCTGGCTCAAGCCCCAGCCCTGGCCCCCAGGACACATGGGAATGGGGTGGCTGTAACCATGACATGGACTTTGGAGAGAAGTTCTCTCGGGATTTCTTGGATTCCAGGGAAGCTCCCCGGGACATCCAGGCACGAATGCGAATCCACAACAACAGGGTGGGGCGCCAGGTGGTAACTGAAAACCTGAAGCGGAAATGCAAGTGTCATGGCACATCAGGCAGCTGCCAGTTCAAGACATGCTGGAGGGCGGCCCCAGAGTTCCGGGCAGTGGGGGCGGCGTTGAGGGAGCGGCTGGGCCGGGCCATCTTCATTGATACCCACAACCGCAATTCTGGAGCCTTCCAGCCCCGTCTGCGTCCCCGTCGCCTCTCAGGAGAGCTGGTCTACTTTGAGAAGTCTCCTGACTTCTGTGAGCGAGACCCCACTATGGGCTCCCCAGGGACAAGGGGCCGGGCCTGCAACAAGACCAGCCGCCTGTTGGATGGCTGTGGCAGCCTGTGCTGTGGCCGTGGGCACAACGTGCTCCGGCAGACACGAGTTGAGCGCTGCCATTGCCGCTTCCACTGGTGCTGCTATGTGCTGTGTGATGAGTGCAAGGTTACAGAGTGGGTGAATGTGTGTAAGTGA
ORF Protein Sequence MLEEPRPRPPPSGLAGLLFLALCSRALSNEILGLKLPGEPPLTANTVCLTLSGLSKRQLGLCLRNPDVTASALQGLHIAVHECQHQLRDQRWNCSALEGGGRLPHHSAILKRGFRESAFSFSMLAAGVMHAVATACSLGKLVSCGCGWKGSGEQDRLRAKLLQLQALSRGKSFPHSLPSPGPGSSPSPGPQDTWEWGGCNHDMDFGEKFSRDFLDSREAPRDIQARMRIHNNRVGRQVVTENLKRKCKCHGTSGSCQFKTCWRAAPEFRAVGAALRERLGRAIFIDTHNRNSGAFQPRLRPRRLSGELVYFEKSPDFCERDPTMGSPGTRGRACNKTSRLLDGCGSLCCGRGHNVLRQTRVERCHCRFHWCCYVLCDECKVTEWVNVCK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1382-Ab Anti-WN10B/ WNT10B/ SHFM6 functional antibody
    Target Antigen GM-Tg-g-SE1382-Ag WNT10B protein
    Cytokine cks-Tg-g-GM-SE1382 wingless-type MMTV integration site family, member 10B (WNT10B) protein & antibody
    ORF Viral Vector pGMLP003631 Human WNT10B Lentivirus plasmid
    ORF Viral Vector pGMLP005563 Human WNT10B Lentivirus plasmid
    ORF Viral Vector pGMLP005576 Human WNT10B Lentivirus plasmid
    ORF Viral Vector vGMLP003631 Human WNT10B Lentivirus particle
    ORF Viral Vector vGMLP005563 Human WNT10B Lentivirus particle
    ORF Viral Vector vGMLP005576 Human WNT10B Lentivirus particle


    Target information

    Target ID GM-SE1382
    Target Name WNT10B
    Gene ID 7480, 22410, 708906, 315294, 101093948, 486561, 539337, 100051649
    Gene Symbol and Synonyms SHFM6,STHAG8,WNT-12,WNT10B,Wnt12
    Uniprot Accession O00744
    Uniprot Entry Name WN10B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000169884
    Target Classification Not Available

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.