Human HTATIP2/CC3/ SDR44U1 ORF/cDNA clone-Lentivirus particle (NM_001098520)
Pre-made Human HTATIP2/CC3/ SDR44U1 Lentiviral expression plasmid for HTATIP2 lentivirus packaging, HTATIP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to HTATIP2/CC3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004848 | Human HTATIP2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004848 |
Gene Name | HTATIP2 |
Accession Number | NM_001098520 |
Gene ID | 10553 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 831 bp |
Gene Alias | CC3, SDR44U1, TIP30 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGGGCCTGCGGCGCTGAGCGCGGCGGCGGCGGCTGCTCTGGCGGCCGCCCTGCTCCTGCTGCGTCGTGAGGACCCGGGGCCGGGGGCTGGCCCCAGCATGGCCGAAACAGAAGCCCTGTCGAAGCTTCGGGAAGACTTCAGGATGCAGAATAAATCCGTCTTTATTTTGGGCGCCAGCGGAGAAACCGGCAGAGTGCTCTTAAAGGAAATCCTGGAGCAGGGCCTGTTTTCCAAAGTCACGCTCATTGGCCGGAGGAAGCTCACCTTCGACGAGGAAGCTTATAAAAATGTGAATCAAGAAGTGGTGGACTTTGAAAAGTTGGATGACTACGCCTCTGCCTTTCAAGGTCATGATGTTGGATTCTGTTGCCTGGGTACCACCAGAGGGAAAGCTGGGGCGGAGGGATTTGTTCGTGTTGACCGAGATTATGTGCTGAAGTCTGCAGAGCTGGCAAAAGCTGGAGGGTGCAAACATTTCAACTTGCTATCCTCTAAAGGAGCTGATAAATCAAGCAATTTTTTATATCTACAAGTTAAGGGAGAAGTAGAAGCCAAGGTTGAAGAATTAAAATTTGATCGTTACTCTGTATTTAGGCCTGGAGTTCTGTTATGTGATAGGCAAGAATCTCGCCCAGGTGAATGGCTGGTTAGAAAGTTCTTTGGCTCCTTACCAGACTCTTGGGCCAGTGGGCATTCTGTGCCTGTGGTGACCGTGGTTAGAGCAATGCTGAACAATGTGGTGAGACCAAGAGACAAGCAGATGGAACTGCTGGAGAACAAGGCCATCCATGACCTGGGGAAAGCGCATGGCTCTCTCAAGCCATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0158-Ab | Anti-HTATIP2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0158-Ag | HTATIP2 protein |
ORF Viral Vector | pGMLV000409 | Human HTATIP2 Lentivirus plasmid |
ORF Viral Vector | pGMLP004848 | Human HTATIP2 Lentivirus plasmid |
ORF Viral Vector | vGMLV000409 | Human HTATIP2 Lentivirus particle |
ORF Viral Vector | vGMLP004848 | Human HTATIP2 Lentivirus particle |
Target information
Target ID | GM-IP0158 |
Target Name | HTATIP2 |
Gene ID | 10553, 53415, 701908, 292935, 101084478, 476886, 539276, 100057340 |
Gene Symbol and Synonyms | CC3,HTATIP2,SDR44U1,TIP30 |
Uniprot Accession | Q9BUP3 |
Uniprot Entry Name | HTAI2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000109854 |
Target Classification | Not Available |
Enables protein serine/threonine kinase activity. Involved in import into nucleus and regulation of angiogenesis. Acts upstream of or within positive regulation of programmed cell death; positive regulation of transcription by RNA polymerase II; and protein autophosphorylation. Located in cytosol and nuclear envelope. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.