Human HTATIP2/CC3/ SDR44U1 ORF/cDNA clone-Lentivirus plasmid (NM_001098520)

Pre-made Human HTATIP2/CC3/ SDR44U1 Lentiviral expression plasmid for HTATIP2 lentivirus packaging, HTATIP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HTATIP2/CC3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004848 Human HTATIP2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004848
Gene Name HTATIP2
Accession Number NM_001098520
Gene ID 10553
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 831 bp
Gene Alias CC3, SDR44U1, TIP30
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCGGGCCTGCGGCGCTGAGCGCGGCGGCGGCGGCTGCTCTGGCGGCCGCCCTGCTCCTGCTGCGTCGTGAGGACCCGGGGCCGGGGGCTGGCCCCAGCATGGCCGAAACAGAAGCCCTGTCGAAGCTTCGGGAAGACTTCAGGATGCAGAATAAATCCGTCTTTATTTTGGGCGCCAGCGGAGAAACCGGCAGAGTGCTCTTAAAGGAAATCCTGGAGCAGGGCCTGTTTTCCAAAGTCACGCTCATTGGCCGGAGGAAGCTCACCTTCGACGAGGAAGCTTATAAAAATGTGAATCAAGAAGTGGTGGACTTTGAAAAGTTGGATGACTACGCCTCTGCCTTTCAAGGTCATGATGTTGGATTCTGTTGCCTGGGTACCACCAGAGGGAAAGCTGGGGCGGAGGGATTTGTTCGTGTTGACCGAGATTATGTGCTGAAGTCTGCAGAGCTGGCAAAAGCTGGAGGGTGCAAACATTTCAACTTGCTATCCTCTAAAGGAGCTGATAAATCAAGCAATTTTTTATATCTACAAGTTAAGGGAGAAGTAGAAGCCAAGGTTGAAGAATTAAAATTTGATCGTTACTCTGTATTTAGGCCTGGAGTTCTGTTATGTGATAGGCAAGAATCTCGCCCAGGTGAATGGCTGGTTAGAAAGTTCTTTGGCTCCTTACCAGACTCTTGGGCCAGTGGGCATTCTGTGCCTGTGGTGACCGTGGTTAGAGCAATGCTGAACAATGTGGTGAGACCAAGAGACAAGCAGATGGAACTGCTGGAGAACAAGGCCATCCATGACCTGGGGAAAGCGCATGGCTCTCTCAAGCCATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0158-Ab Anti-HTATIP2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0158-Ag HTATIP2 protein
    ORF Viral Vector pGMLV000409 Human HTATIP2 Lentivirus plasmid
    ORF Viral Vector pGMLP004848 Human HTATIP2 Lentivirus plasmid
    ORF Viral Vector vGMLV000409 Human HTATIP2 Lentivirus particle
    ORF Viral Vector vGMLP004848 Human HTATIP2 Lentivirus particle


    Target information

    Target ID GM-IP0158
    Target Name HTATIP2
    Gene ID 10553, 53415, 701908, 292935, 101084478, 476886, 539276, 100057340
    Gene Symbol and Synonyms CC3,HTATIP2,SDR44U1,TIP30
    Uniprot Accession Q9BUP3
    Uniprot Entry Name HTAI2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000109854
    Target Classification Not Available

    Enables protein serine/threonine kinase activity. Involved in import into nucleus and regulation of angiogenesis. Acts upstream of or within positive regulation of programmed cell death; positive regulation of transcription by RNA polymerase II; and protein autophosphorylation. Located in cytosol and nuclear envelope. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.