Human TSPAN8/CO-029/ TM4SF3 ORF/cDNA clone-Lentivirus particle (NM_004616)
Pre-made Human TSPAN8/CO-029/ TM4SF3 Lentiviral expression plasmid for TSPAN8 lentivirus packaging, TSPAN8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TSPAN8/CO-029 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004843 | Human TSPAN8 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004843 |
Gene Name | TSPAN8 |
Accession Number | NM_004616 |
Gene ID | 7103 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 714 bp |
Gene Alias | CO-029, TM4SF3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCAGGTGTGAGTGCCTGTATAAAATATTCTATGTTTACCTTCAACTTCTTGTTCTGGCTATGTGGTATCTTGATCCTAGCATTAGCAATATGGGTACGAGTAAGCAATGACTCTCAAGCAATTTTTGGTTCTGAAGATGTAGGCTCTAGCTCCTACGTTGCTGTGGACATATTGATTGCTGTAGGTGCCATCATCATGATTCTGGGCTTCCTGGGATGCTGCGGTGCTATAAAAGAAAGTCGCTGCATGCTTCTGTTGTTTTTCATAGGCTTGCTTCTGATCCTGCTCCTGCAGGTGGCGACAGGTATCCTAGGAGCTGTTTTCAAATCTAAGTCTGATCGCATTGTGAATGAAACTCTCTATGAAAACACAAAGCTTTTGAGCGCCACAGGGGAAAGTGAAAAACAATTCCAGGAAGCCATAATTGTGTTTCAAGAAGAGTTTAAATGCTGCGGTTTGGTCAATGGAGCTGCTGATTGGGGAAATAATTTTCAACACTATCCTGAATTATGTGCCTGTCTAGATAAGCAGAGACCATGCCAAAGCTATAATGGAAAACAAGTTTACAAAGAGACCTGTATTTCTTTCATAAAAGACTTCTTGGCAAAAAATTTGATTATAGTTATTGGAATATCATTTGGACTGGCAGTTATTGAGATACTGGGTTTGGTGTTTTCTATGGTCCTGTATTGCCAGATCGGGAACAAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2195-Ab | Anti-TSPAN8 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2195-Ag | TSPAN8 protein |
ORF Viral Vector | pGMLP004843 | Human TSPAN8 Lentivirus plasmid |
ORF Viral Vector | vGMLP004843 | Human TSPAN8 Lentivirus particle |
Target information
Target ID | GM-IP2195 |
Target Name | TSPAN8 |
Gene ID | 7103, 216350, 718622, 171048, 101101146, 474448, 617508, 100064038 |
Gene Symbol and Synonyms | CO-029,CO-29,E330007O21Rik,TM4SF3,TSPAN-8,TSPAN8 |
Uniprot Accession | P19075 |
Uniprot Entry Name | TSN8_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000127324 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.