Human TSPAN8/CO-029/TM4SF3 ORF/cDNA clone-Lentivirus plasmid (NM_004616)

SKU: pGMLP004843
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSPAN8/CO-029/TM4SF3 Lentiviral expression plasmid for TSPAN8 lentivirus packaging, TSPAN8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TSPAN8/CO-029 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $478.5
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP004843
Gene Name TSPAN8
Accession Number NM_004616
Gene ID 7103
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 714 bp
Gene Alias CO-029,TM4SF3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGGTGTGAGTGCCTGTATAAAATATTCTATGTTTACCTTCAACTTCTTGTTCTGGCTATGTGGTATCTTGATCCTAGCATTAGCAATATGGGTACGAGTAAGCAATGACTCTCAAGCAATTTTTGGTTCTGAAGATGTAGGCTCTAGCTCCTACGTTGCTGTGGACATATTGATTGCTGTAGGTGCCATCATCATGATTCTGGGCTTCCTGGGATGCTGCGGTGCTATAAAAGAAAGTCGCTGCATGCTTCTGTTGTTTTTCATAGGCTTGCTTCTGATCCTGCTCCTGCAGGTGGCGACAGGTATCCTAGGAGCTGTTTTCAAATCTAAGTCTGATCGCATTGTGAATGAAACTCTCTATGAAAACACAAAGCTTTTGAGCGCCACAGGGGAAAGTGAAAAACAATTCCAGGAAGCCATAATTGTGTTTCAAGAAGAGTTTAAATGCTGCGGTTTGGTCAATGGAGCTGCTGATTGGGGAAATAATTTTCAACACTATCCTGAATTATGTGCCTGTCTAGATAAGCAGAGACCATGCCAAAGCTATAATGGAAAACAAGTTTACAAAGAGACCTGTATTTCTTTCATAAAAGACTTCTTGGCAAAAAATTTGATTATAGTTATTGGAATATCATTTGGACTGGCAGTTATTGAGATACTGGGTTTGGTGTTTTCTATGGTCCTGTATTGCCAGATCGGGAACAAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2195-Ab Anti-TSPAN8 monoclonal antibody
    Target Antigen GM-Tg-g-IP2195-Ag TSPAN8 protein
    ORF Viral Vector pGMLP004843 Human TSPAN8 Lentivirus plasmid
    ORF Viral Vector vGMLP004843 Human TSPAN8 Lentivirus particle


    Target information

    Target ID GM-IP2195
    Target Name TSPAN8
    Gene ID 7103, 216350, 718622, 171048, 101101146, 474448, 617508, 100064038
    Gene Symbol and Synonyms CO-029,CO-29,E330007O21Rik,TM4SF3,TSPAN-8,TSPAN8
    Uniprot Accession P19075
    Uniprot Entry Name TSN8_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000127324
    Target Classification Not Available

    The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.