Human TSLP ORF/cDNA clone-Lentivirus particle (NM_033035)
Pre-made Human TSLP/ Lentiviral expression plasmid for TSLP lentivirus packaging, TSLP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TSLP/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004781 | Human TSLP Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004781 |
Gene Name | TSLP |
Accession Number | NM_033035 |
Gene ID | 85480 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 480 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTCCCTTTTGCCTTACTATATGTTCTGTCAGTTTCTTTCAGGAAAATCTTCATCTTACAACTTGTAGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAAGATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGACCAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACAACAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-567 | Pre-Made Tezepelumab biosimilar, Whole Mab: Anti-TSLP therapeutic antibody |
Biosimilar | GMP-Bios-ab-662 | Pre-Made Ecleralimab biosimilar, Whole Mab: Anti-TSLP therapeutic antibody |
Target Antibody | GM-Tg-g-T85857-Ab | Anti-TSLP functional antibody |
Target Antigen | GM-Tg-g-T85857-Ag | TSLP protein |
ORF Viral Vector | pGMLP004781 | Human TSLP Lentivirus plasmid |
ORF Viral Vector | vGMLP004781 | Human TSLP Lentivirus particle |
Target information
Target ID | GM-T85857 |
Target Name | TSLP |
Gene ID | 85480, 53603, 706194, 688621, 101085857, 607671, 617637, 100302635 |
Gene Symbol and Synonyms | TSLP |
Uniprot Accession | Q969D9 |
Uniprot Entry Name | TSLP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000145777 |
Target Classification | Not Available |
This gene encodes a hemopoietic cytokine proposed to signal through a heterodimeric receptor complex composed of the thymic stromal lymphopoietin receptor and the IL-7R alpha chain. It mainly impacts myeloid cells and induces the release of T cell-attracting chemokines from monocytes and enhances the maturation of CD11c(+) dendritic cells. The protein promotes T helper type 2 (TH2) cell responses that are associated with immunity in various inflammatory diseases, including asthma, allergic inflammation and chronic obstructive pulmonary disease. The protein is therefore considered a potential therapeutic target for the treatment of such diseases. In addition, the shorter (predominant) isoform is an antimicrobial protein, displaying antibacterial and antifungal activity against B. cereus, E. coli, E. faecalis, S. mitis, S. epidermidis, and C. albicans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.