Human TSLP ORF/cDNA clone-Lentivirus plasmid (NM_033035)

Cat. No.: pGMLP004781
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSLP/ Lentiviral expression plasmid for TSLP lentivirus packaging, TSLP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to TSLP/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP004781
Gene Name TSLP
Accession Number NM_033035
Gene ID 85480
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 480 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTCCCTTTTGCCTTACTATATGTTCTGTCAGTTTCTTTCAGGAAAATCTTCATCTTACAACTTGTAGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAAGATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGACCAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACAACAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-567 Pre-Made Tezepelumab biosimilar, Whole Mab: Anti-TSLP therapeutic antibody
    Biosimilar GMP-Bios-ab-662 Pre-Made Ecleralimab biosimilar, Whole Mab: Anti-TSLP therapeutic antibody
    Target Antibody GM-Tg-g-T85857-Ab Anti-TSLP functional antibody
    Target Antigen GM-Tg-g-T85857-Ag TSLP protein
    ORF Viral Vector pGMLP004781 Human TSLP Lentivirus plasmid
    ORF Viral Vector vGMLP004781 Human TSLP Lentivirus particle


    Target information

    Target ID GM-T85857
    Target Name TSLP
    Gene ID 85480, 53603, 706194, 688621, 101085857, 607671, 617637, 100302635
    Gene Symbol and Synonyms TSLP
    Uniprot Accession Q969D9
    Uniprot Entry Name TSLP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000145777
    Target Classification Not Available

    This gene encodes a hemopoietic cytokine proposed to signal through a heterodimeric receptor complex composed of the thymic stromal lymphopoietin receptor and the IL-7R alpha chain. It mainly impacts myeloid cells and induces the release of T cell-attracting chemokines from monocytes and enhances the maturation of CD11c(+) dendritic cells. The protein promotes T helper type 2 (TH2) cell responses that are associated with immunity in various inflammatory diseases, including asthma, allergic inflammation and chronic obstructive pulmonary disease. The protein is therefore considered a potential therapeutic target for the treatment of such diseases. In addition, the shorter (predominant) isoform is an antimicrobial protein, displaying antibacterial and antifungal activity against B. cereus, E. coli, E. faecalis, S. mitis, S. epidermidis, and C. albicans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.