Human Gkn2/BRICD1B/GDDR ORF/cDNA clone-Lentivirus particle (NM_182536)

Cat. No.: vGMLP004593

Pre-made Human Gkn2/BRICD1B/GDDR Lentiviral expression plasmid for Gkn2 lentivirus packaging, Gkn2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GKN2/Gkn2/BRICD1B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004593 Human Gkn2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004593
Gene Name Gkn2
Accession Number NM_182536
Gene ID 200504
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 555 bp
Gene Alias BRICD1B,GDDR,PRO813,TFIZ1,VLTI465
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAAATACTTGTGGCATTTCTGGTGGTGCTGACCATCTTTGGGATACAATCTCATGGATACGAGGTTTTTAACATCATCAGCCCAAGCAACAATGGTGGCAATGTTCAGGAGACAGTGACAATTGATAATGAAAAAAATACCGCCATCATTAACATCCATGCAGGATCATGCTCTTCTACCACAATTTTTGACTATAAACATGGCTACATTGCATCCAGGGTGCTCTCCCGAAGAGCCTGCTTTATCCTGAAGATGGACCATCAGAACATCCCTCCTCTGAACAATCTCCAATGGTACATCTATGAGAAACAGGCTCTGGACAACATGTTCTCCAGCAAATACACCTGGGTCAAGTACAACCCTCTGGAGTCTCTGATCAAAGACGTGGATTGGTTCCTGCTTGGGTCACCCATTGAGAAACTCTGCAAACATATCCCTTTGTATAAGGGGGAAGTGGTTGAAAACACACATAATGTCGGTGCTGGAGGCTGTGCAAAGGCTGGGCTCCTGGGCATCTTGGGAATTTCAATCTGTGCAGACATTCATGTTTAG
ORF Protein Sequence MKILVAFLVVLTIFGIQSHGYEVFNIISPSNNGGNVQETVTIDNEKNTAIINIHAGSCSSTTIFDYKHGYIASRVLSRRACFILKMDHQNIPPLNNLQWYIYEKQALDNMFSSKYTWVKYNPLESLIKDVDWFLLGSPIEKLCKHIPLYKGEVVENTHNVGAGGCAKAGLLGILGISICADIHV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0947-Ab Anti-GKN2/ BRICD1B/ GDDR functional antibody
    Target Antigen GM-Tg-g-SE0947-Ag GKN2 protein
    ORF Viral Vector pGMLP004593 Human Gkn2 Lentivirus plasmid
    ORF Viral Vector vGMLP004593 Human Gkn2 Lentivirus particle


    Target information

    Target ID GM-SE0947
    Target Name GKN2
    Gene ID 200504, 66284, 700323, 297419, 101093178, 612594, 512001, 100061407
    Gene Symbol and Synonyms 1810036H07Rik,BRICD1B,GDDR,GKN2,PRO813,RGD1311934,TFIZ1,VLTI465
    Uniprot Accession Q86XP6
    Uniprot Entry Name GKN2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000183607
    Target Classification Not Available

    The secretory protein encoded by this gene is produced in gastric surface mucous cells, where it can bind trefoil factor family peptide 1 or gastrokine-1. This gene may be a tumor suppressor gene, as its expression is markedly decreased in gastric cancer tissues. The encoded protein interacts with gastrokine-1 and regulates homeostasis of the gastric mucosa. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.