Human Gkn2/BRICD1B/GDDR ORF/cDNA clone-Lentivirus plasmid (NM_182536)
Cat. No.: pGMLP004593
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human Gkn2/BRICD1B/GDDR Lentiviral expression plasmid for Gkn2 lentivirus packaging, Gkn2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GKN2/Gkn2/BRICD1B products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004593 |
Gene Name | Gkn2 |
Accession Number | NM_182536 |
Gene ID | 200504 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 555 bp |
Gene Alias | BRICD1B,GDDR,PRO813,TFIZ1,VLTI465 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAAATACTTGTGGCATTTCTGGTGGTGCTGACCATCTTTGGGATACAATCTCATGGATACGAGGTTTTTAACATCATCAGCCCAAGCAACAATGGTGGCAATGTTCAGGAGACAGTGACAATTGATAATGAAAAAAATACCGCCATCATTAACATCCATGCAGGATCATGCTCTTCTACCACAATTTTTGACTATAAACATGGCTACATTGCATCCAGGGTGCTCTCCCGAAGAGCCTGCTTTATCCTGAAGATGGACCATCAGAACATCCCTCCTCTGAACAATCTCCAATGGTACATCTATGAGAAACAGGCTCTGGACAACATGTTCTCCAGCAAATACACCTGGGTCAAGTACAACCCTCTGGAGTCTCTGATCAAAGACGTGGATTGGTTCCTGCTTGGGTCACCCATTGAGAAACTCTGCAAACATATCCCTTTGTATAAGGGGGAAGTGGTTGAAAACACACATAATGTCGGTGCTGGAGGCTGTGCAAAGGCTGGGCTCCTGGGCATCTTGGGAATTTCAATCTGTGCAGACATTCATGTTTAG |
ORF Protein Sequence | MKILVAFLVVLTIFGIQSHGYEVFNIISPSNNGGNVQETVTIDNEKNTAIINIHAGSCSSTTIFDYKHGYIASRVLSRRACFILKMDHQNIPPLNNLQWYIYEKQALDNMFSSKYTWVKYNPLESLIKDVDWFLLGSPIEKLCKHIPLYKGEVVENTHNVGAGGCAKAGLLGILGISICADIHV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0947-Ab | Anti-GKN2/ BRICD1B/ GDDR functional antibody |
Target Antigen | GM-Tg-g-SE0947-Ag | GKN2 protein |
ORF Viral Vector | pGMLP004593 | Human Gkn2 Lentivirus plasmid |
ORF Viral Vector | vGMLP004593 | Human Gkn2 Lentivirus particle |
Target information
Target ID | GM-SE0947 |
Target Name | GKN2 |
Gene ID | 200504, 66284, 700323, 297419, 101093178, 612594, 512001, 100061407 |
Gene Symbol and Synonyms | 1810036H07Rik,BRICD1B,GDDR,GKN2,PRO813,RGD1311934,TFIZ1,VLTI465 |
Uniprot Accession | Q86XP6 |
Uniprot Entry Name | GKN2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000183607 |
Target Classification | Not Available |
The secretory protein encoded by this gene is produced in gastric surface mucous cells, where it can bind trefoil factor family peptide 1 or gastrokine-1. This gene may be a tumor suppressor gene, as its expression is markedly decreased in gastric cancer tissues. The encoded protein interacts with gastrokine-1 and regulates homeostasis of the gastric mucosa. [provided by RefSeq, Dec 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.