Human UCN3/SCP/ SPC ORF/cDNA clone-Lentivirus particle (NM_053049)
Pre-made Human UCN3/SCP/ SPC Lentiviral expression plasmid for UCN3 lentivirus packaging, UCN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to UCN3/SCP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004588 | Human UCN3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004588 |
Gene Name | UCN3 |
Accession Number | NM_053049 |
Gene ID | 114131 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 486 bp |
Gene Alias | SCP, SPC, UCNIII |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGATGCCGGTCCACTTCCTGCTGCTCCTGCTGCTGCTCCTGGGGGGCCCCAGGACAGGCCTCCCCCACAAGTTCTACAAAGCCAAGCCCATCTTCAGCTGCCTCAACACCGCCCTGTCTGAGGCTGAGAAGGGCCAGTGGGAGGATGCATCCCTGCTGAGCAAGAGGAGCTTCCACTACCTGCGCAGCAGAGACGCCTCTTCGGGAGAGGAGGAGGAGGGCAAAGAGAAAAAGACTTTCCCCATCTCTGGGGCCAGGGGTGGAGCCAGAGGCACCCGGTACAGATACGTGTCCCAAGCACAGCCCAGGGGAAAGCCACGCCAGGACACGGCCAAGAGTCCCCACCGCACCAAGTTCACCCTGTCCCTCGACGTCCCCACCAACATCATGAACCTCCTCTTCAACATCGCCAAGGCCAAGAACCTGCGTGCCCAGGCGGCCGCCAATGCCCACCTGATGGCGCAAATTGGGAGGAAGAAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1357-Ab | Anti-UCN3/ SCP/ SPC functional antibody |
Target Antigen | GM-Tg-g-SE1357-Ag | UCN3 protein |
ORF Viral Vector | pGMLP004588 | Human UCN3 Lentivirus plasmid |
ORF Viral Vector | vGMLP004588 | Human UCN3 Lentivirus particle |
Target information
Target ID | GM-SE1357 |
Target Name | UCN3 |
Gene ID | 114131, 83428, 711921, 498791, 101098548, 100856134, 751573, 100057172 |
Gene Symbol and Synonyms | RGD1562213,SCP,SPC,ucn III,UCN3,UCNIII |
Uniprot Accession | Q969E3 |
Uniprot Entry Name | UCN3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000178473 |
Target Classification | Not Available |
This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family of proteins. The encoded preproprotein is proteolytically processed to generate the mature peptide hormone, which is secreted by pancreatic beta and alpha cells. This hormone is an endogenous ligand for corticotropin-releasing factor receptor 2 and may regulate insulin secretion in response to plasma glucose levels. Patients with type 2 diabetes exhibit reduced levels of the encoded protein in beta cells. In the brain, the encoded protein may be responsible for the effects of stress on appetite. [provided by RefSeq, May 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.