Human UCN3/SCP/ SPC ORF/cDNA clone-Lentivirus plasmid (NM_053049)

Pre-made Human UCN3/SCP/ SPC Lentiviral expression plasmid for UCN3 lentivirus packaging, UCN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to UCN3/SCP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004588 Human UCN3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004588
Gene Name UCN3
Accession Number NM_053049
Gene ID 114131
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 486 bp
Gene Alias SCP, SPC, UCNIII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGATGCCGGTCCACTTCCTGCTGCTCCTGCTGCTGCTCCTGGGGGGCCCCAGGACAGGCCTCCCCCACAAGTTCTACAAAGCCAAGCCCATCTTCAGCTGCCTCAACACCGCCCTGTCTGAGGCTGAGAAGGGCCAGTGGGAGGATGCATCCCTGCTGAGCAAGAGGAGCTTCCACTACCTGCGCAGCAGAGACGCCTCTTCGGGAGAGGAGGAGGAGGGCAAAGAGAAAAAGACTTTCCCCATCTCTGGGGCCAGGGGTGGAGCCAGAGGCACCCGGTACAGATACGTGTCCCAAGCACAGCCCAGGGGAAAGCCACGCCAGGACACGGCCAAGAGTCCCCACCGCACCAAGTTCACCCTGTCCCTCGACGTCCCCACCAACATCATGAACCTCCTCTTCAACATCGCCAAGGCCAAGAACCTGCGTGCCCAGGCGGCCGCCAATGCCCACCTGATGGCGCAAATTGGGAGGAAGAAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1357-Ab Anti-UCN3/ SCP/ SPC functional antibody
    Target Antigen GM-Tg-g-SE1357-Ag UCN3 protein
    ORF Viral Vector pGMLP004588 Human UCN3 Lentivirus plasmid
    ORF Viral Vector vGMLP004588 Human UCN3 Lentivirus particle


    Target information

    Target ID GM-SE1357
    Target Name UCN3
    Gene ID 114131, 83428, 711921, 498791, 101098548, 100856134, 751573, 100057172
    Gene Symbol and Synonyms RGD1562213,SCP,SPC,ucn III,UCN3,UCNIII
    Uniprot Accession Q969E3
    Uniprot Entry Name UCN3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000178473
    Target Classification Not Available

    This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family of proteins. The encoded preproprotein is proteolytically processed to generate the mature peptide hormone, which is secreted by pancreatic beta and alpha cells. This hormone is an endogenous ligand for corticotropin-releasing factor receptor 2 and may regulate insulin secretion in response to plasma glucose levels. Patients with type 2 diabetes exhibit reduced levels of the encoded protein in beta cells. In the brain, the encoded protein may be responsible for the effects of stress on appetite. [provided by RefSeq, May 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.