Human TNFSF18/AITRL/GITRL ORF/cDNA clone-Lentivirus particle (NM_005092)
Cat. No.: vGMLP004444
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TNFSF18/AITRL/GITRL Lentiviral expression plasmid for TNFSF18 lentivirus packaging, TNFSF18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
TNFSF18/AITRL products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004444 | Human TNFSF18 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004444 |
Gene Name | TNFSF18 |
Accession Number | NM_005092 |
Gene ID | 8995 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 600 bp |
Gene Alias | AITRL,GITRL,hGITRL,TL6,TNLG2A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACATTGCATCCTTCACCCATCACTTGTGAATTTTTGTTTTCCACAGCTCTCATTTCTCCAAAAATGTGTTTGAGCCACTTGGAAAATATGCCTTTAAGCCATTCAAGAACTCAAGGAGCTCAGAGATCATCCTGGAAGCTGTGGCTCTTTTGCTCAATAGTTATGTTGCTATTTCTTTGCTCCTTCAGTTGGCTAATCTTTATTTTTCTCCAATTAGAGACTGCTAAGGAGCCCTGTATGGCTAAGTTTGGACCATTACCCTCAAAATGGCAAATGGCATCTTCTGAACCTCCTTGCGTGAATAAGGTGTCTGACTGGAAGCTGGAGATACTTCAGAATGGCTTATATTTAATTTATGGCCAAGTGGCTCCCAATGCAAACTACAATGATGTAGCTCCTTTTGAGGTGCGGCTGTATAAAAACAAAGACATGATACAAACTCTAACAAACAAATCTAAAATCCAAAATGTAGGAGGGACTTATGAATTGCATGTTGGGGACACCATAGACTTGATATTCAACTCTGAGCATCAGGTTCTAAAAAATAATACATACTGGGGTATCATTTTACTAGCAAATCCCCAATTCATCTCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1858-Ab | Anti-TNF18/ TNFSF18/ AITRL monoclonal antibody |
Target Antigen | GM-Tg-g-MP1858-Ag | TNFSF18 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1858 | tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18) protein & antibody |
ORF Viral Vector | pGMLP004444 | Human TNFSF18 Lentivirus plasmid |
ORF Viral Vector | vGMLP004444 | Human TNFSF18 Lentivirus particle |
Target information
Target ID | GM-MP1858 |
Target Name | TNFSF18 |
Gene ID | 8995, 240873, 678654, 364031, 101091748, 100855912, 768081, 100060504 |
Gene Symbol and Synonyms | AITRL,GITRL,hGITRL,TL6,TNFSF18,TNLG2A |
Uniprot Accession | Q9UNG2 |
Uniprot Entry Name | TNF18_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000120337 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.