Human TNFSF18/AITRL/GITRL ORF/cDNA clone-Lentivirus plasmid (NM_005092)

Cat. No.: pGMLP004444
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TNFSF18/AITRL/GITRL Lentiviral expression plasmid for TNFSF18 lentivirus packaging, TNFSF18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to TNFSF18/AITRL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP004444
Gene Name TNFSF18
Accession Number NM_005092
Gene ID 8995
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 600 bp
Gene Alias AITRL,GITRL,hGITRL,TL6,TNLG2A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACATTGCATCCTTCACCCATCACTTGTGAATTTTTGTTTTCCACAGCTCTCATTTCTCCAAAAATGTGTTTGAGCCACTTGGAAAATATGCCTTTAAGCCATTCAAGAACTCAAGGAGCTCAGAGATCATCCTGGAAGCTGTGGCTCTTTTGCTCAATAGTTATGTTGCTATTTCTTTGCTCCTTCAGTTGGCTAATCTTTATTTTTCTCCAATTAGAGACTGCTAAGGAGCCCTGTATGGCTAAGTTTGGACCATTACCCTCAAAATGGCAAATGGCATCTTCTGAACCTCCTTGCGTGAATAAGGTGTCTGACTGGAAGCTGGAGATACTTCAGAATGGCTTATATTTAATTTATGGCCAAGTGGCTCCCAATGCAAACTACAATGATGTAGCTCCTTTTGAGGTGCGGCTGTATAAAAACAAAGACATGATACAAACTCTAACAAACAAATCTAAAATCCAAAATGTAGGAGGGACTTATGAATTGCATGTTGGGGACACCATAGACTTGATATTCAACTCTGAGCATCAGGTTCTAAAAAATAATACATACTGGGGTATCATTTTACTAGCAAATCCCCAATTCATCTCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1858-Ab Anti-TNF18/ TNFSF18/ AITRL monoclonal antibody
    Target Antigen GM-Tg-g-MP1858-Ag TNFSF18 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1858 tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18) protein & antibody
    ORF Viral Vector pGMLP004444 Human TNFSF18 Lentivirus plasmid
    ORF Viral Vector vGMLP004444 Human TNFSF18 Lentivirus particle


    Target information

    Target ID GM-MP1858
    Target Name TNFSF18
    Gene ID 8995, 240873, 678654, 364031, 101091748, 100855912, 768081, 100060504
    Gene Symbol and Synonyms AITRL,GITRL,hGITRL,TL6,TNFSF18,TNLG2A
    Uniprot Accession Q9UNG2
    Uniprot Entry Name TNF18_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000120337
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.