Human ADRB2/ADRB2R/ADRBR ORF/cDNA clone-Lentivirus particle (NM_000024)

SKU: vGMLP003663
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ADRB2/ADRB2R/ADRBR Lentiviral expression plasmid for ADRB2 lentivirus packaging, ADRB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to ADRB2/ADRB2R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003663 Human ADRB2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003663
Gene Name ADRB2
Accession Number NM_000024
Gene ID 154
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1242 bp
Gene Alias ADRB2R,ADRBR,B2AR,BAR,BETA2AR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGCAACCCGGGAACGGCAGCGCCTTCTTGCTGGCACCCAATAGAAGCCATGCGCCGGACCACGACGTCACGCAGCAAAGGGACGAGGTGTGGGTGGTGGGCATGGGCATCGTCATGTCTCTCATCGTCCTGGCCATCGTGTTTGGCAATGTGCTGGTCATCACAGCCATTGCCAAGTTCGAGCGTCTGCAGACGGTCACCAACTACTTCATCACTTCACTGGCCTGTGCTGATCTGGTCATGGGCCTGGCAGTGGTGCCCTTTGGGGCCGCCCATATTCTTATGAAAATGTGGACTTTTGGCAACTTCTGGTGCGAGTTTTGGACTTCCATTGATGTGCTGTGCGTCACGGCCAGCATTGAGACCCTGTGCGTGATCGCAGTGGATCGCTACTTTGCCATTACTTCACCTTTCAAGTACCAGAGCCTGCTGACCAAGAATAAGGCCCGGGTGATCATTCTGATGGTGTGGATTGTGTCAGGCCTTACCTCCTTCTTGCCCATTCAGATGCACTGGTACCGGGCCACCCACCAGGAAGCCATCAACTGCTATGCCAATGAGACCTGCTGTGACTTCTTCACGAACCAAGCCTATGCCATTGCCTCTTCCATCGTGTCCTTCTACGTTCCCCTGGTGATCATGGTCTTCGTCTACTCCAGGGTCTTTCAGGAGGCCAAAAGGCAGCTCCAGAAGATTGACAAATCTGAGGGCCGCTTCCATGTCCAGAACCTTAGCCAGGTGGAGCAGGATGGGCGGACGGGGCATGGACTCCGCAGATCTTCCAAGTTCTGCTTGAAGGAGCACAAAGCCCTCAAGACGTTAGGCATCATCATGGGCACTTTCACCCTCTGCTGGCTGCCCTTCTTCATCGTTAACATTGTGCATGTGATCCAGGATAACCTCATCCGTAAGGAAGTTTACATCCTCCTAAATTGGATAGGCTATGTCAATTCTGGTTTCAATCCCCTTATCTACTGCCGGAGCCCAGATTTCAGGATTGCCTTCCAGGAGCTTCTGTGCCTGCGCAGGTCTTCTTTGAAGGCCTATGGGAATGGCTACTCCAGCAACGGCAACACAGGGGAGCAGAGTGGATATCACGTGGAACAGGAGAAAGAAAATAAACTGCTGTGTGAAGACCTCCCAGGCACGGAAGACTTTGTGGGCCATCAAGGTACTGTGCCTAGCGATAACATTGATTCACAAGGGAGGAATTGTAGTACAAATGACTCACTGCTGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T52522-Ab Anti-ADRB2/ ADRB2R/ ADRBR monoclonal antibody
    Target Antigen GM-Tg-g-T52522-Ag ADRB2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003663 Human ADRB2 Lentivirus plasmid
    ORF Viral Vector pGMLV000869 Human ADRB2 Lentivirus plasmid
    ORF Viral Vector pGMPC000618 Human ADRB2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003663 Human ADRB2 Lentivirus particle
    ORF Viral Vector vGMLV000869 Human ADRB2 Lentivirus particle


    Target information

    Target ID GM-T52522
    Target Name ADRB2
    Gene ID 154, 11555, 710146, 24176, 493767, 403910, 281605, 100060659
    Gene Symbol and Synonyms Adrb-2,ADRB2,ADRB2R,ADRBR,B2AR,Badm,BAR,BETA2AR,Gpcr7
    Uniprot Accession P07550
    Uniprot Entry Name ADRB2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000169252
    Target Classification GPCR, Tumor-associated antigen (TAA)

    This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific and rapid signaling by this G protein-coupled receptor. This receptor is also a transcription regulator of the alpha-synuclein gene, and together, both genes are believed to be associated with risk of Parkinson's Disease. This gene is intronless. Different polymorphic forms, point mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity, type 2 diabetes and cardiovascular disease. [provided by RefSeq, Oct 2019]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.