Human MESD/BOCA/ MESDC2 ORF/cDNA clone-Lentivirus particle (NM_015154)

Pre-made Human MESD/BOCA/ MESDC2 Lentiviral expression plasmid for MESD lentivirus packaging, MESD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MESD/BOCA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003470 Human MESD Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003470
Gene Name MESD
Accession Number NM_015154
Gene ID 23184
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 705 bp
Gene Alias BOCA, MESDC2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGCTTCCAGGTGGGCGCGCAAGGCCGTGGTCCTGCTTTGTGCCTCTGACCTGCTGCTGCTGCTGCTACTGCTACCACCGCCTGGGTCCTGCGCGGCCGAAGGCTCGCCCGGGACGCCCGACGAGTCTACCCCACCTCCCCGGAAGAAGAAGAAGGATATTCGCGATTACAATGATGCAGACATGGCGCGTCTTCTGGAGCAATGGGAGAAAGATGATGACATTGAAGAAGGAGATCTTCCAGAGCACAAGAGACCTTCAGCACCTGTCGACTTCTCAAAGATAGACCCAAGCAAGCCTGAAAGCATATTGAAAATGACGAAAAAAGGGAAGACTCTCATGATGTTTGTCACTGTATCAGGAAGCCCTACTGAGAAGGAGACAGAGGAAATTACGAGCCTCTGGCAGGGCAGCCTTTTCAATGCCAACTATGACGTCCAGAGGTTCATTGTGGGATCAGACCGTGCTATCTTCATGCTTCGCGATGGGAGCTACGCCTGGGAGATCAAGGACTTTTTGGTCGGTCAAGACAGGTGTGCTGATGTAACTCTGGAGGGCCAGGTGTACCCCGGCAAAGGAGGAGGAAGCAAAGAGAAAAATAAAACAAAGCAAGACAAGGGCAAAAAAAAGAAGGAAGGAGATCTGAAATCTCGGTCTTCCAAGGAAGAAAATCGAGCTGGGAATAAAAGAGAAGACCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2585-Ab Anti-MESD/ BOCAC2 monoclonal antibody
    Target Antigen GM-Tg-g-MP2585-Ag MESD VLP (virus-like particle)
    ORF Viral Vector pGMLP000952 Human MESD Lentivirus plasmid
    ORF Viral Vector pGMLP003470 Human MESD Lentivirus plasmid
    ORF Viral Vector vGMLP000952 Human MESD Lentivirus particle
    ORF Viral Vector vGMLP003470 Human MESD Lentivirus particle


    Target information

    Target ID GM-MP2585
    Target Name MESD
    Gene ID 23184, 67943, 712993, 308796, 101094422, 488765, 514610, 100067329
    Gene Symbol and Synonyms 2210015O11Rik,BOCA,MESD,MESDC2,mKIAA0081,msd,OI20
    Uniprot Accession Q14696
    Uniprot Entry Name MESD_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000117899
    Target Classification Not Available

    Predicted to enable low-density lipoprotein particle receptor binding activity. Involved in ossification and protein folding. Located in endoplasmic reticulum. Implicated in osteogenesis imperfecta type 20. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.