Human MESD/BOCA/ MESDC2 ORF/cDNA clone-Lentivirus plasmid (NM_015154)
Pre-made Human MESD/BOCA/ MESDC2 Lentiviral expression plasmid for MESD lentivirus packaging, MESD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MESD/BOCA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003470 | Human MESD Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003470 |
Gene Name | MESD |
Accession Number | NM_015154 |
Gene ID | 23184 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 705 bp |
Gene Alias | BOCA, MESDC2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCTTCCAGGTGGGCGCGCAAGGCCGTGGTCCTGCTTTGTGCCTCTGACCTGCTGCTGCTGCTGCTACTGCTACCACCGCCTGGGTCCTGCGCGGCCGAAGGCTCGCCCGGGACGCCCGACGAGTCTACCCCACCTCCCCGGAAGAAGAAGAAGGATATTCGCGATTACAATGATGCAGACATGGCGCGTCTTCTGGAGCAATGGGAGAAAGATGATGACATTGAAGAAGGAGATCTTCCAGAGCACAAGAGACCTTCAGCACCTGTCGACTTCTCAAAGATAGACCCAAGCAAGCCTGAAAGCATATTGAAAATGACGAAAAAAGGGAAGACTCTCATGATGTTTGTCACTGTATCAGGAAGCCCTACTGAGAAGGAGACAGAGGAAATTACGAGCCTCTGGCAGGGCAGCCTTTTCAATGCCAACTATGACGTCCAGAGGTTCATTGTGGGATCAGACCGTGCTATCTTCATGCTTCGCGATGGGAGCTACGCCTGGGAGATCAAGGACTTTTTGGTCGGTCAAGACAGGTGTGCTGATGTAACTCTGGAGGGCCAGGTGTACCCCGGCAAAGGAGGAGGAAGCAAAGAGAAAAATAAAACAAAGCAAGACAAGGGCAAAAAAAAGAAGGAAGGAGATCTGAAATCTCGGTCTTCCAAGGAAGAAAATCGAGCTGGGAATAAAAGAGAAGACCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2585-Ab | Anti-MESD/ BOCAC2 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2585-Ag | MESD VLP (virus-like particle) |
ORF Viral Vector | pGMLP000952 | Human MESD Lentivirus plasmid |
ORF Viral Vector | pGMLP003470 | Human MESD Lentivirus plasmid |
ORF Viral Vector | vGMLP000952 | Human MESD Lentivirus particle |
ORF Viral Vector | vGMLP003470 | Human MESD Lentivirus particle |
Target information
Target ID | GM-MP2585 |
Target Name | MESD |
Gene ID | 23184, 67943, 712993, 308796, 101094422, 488765, 514610, 100067329 |
Gene Symbol and Synonyms | 2210015O11Rik,BOCA,MESD,MESDC2,mKIAA0081,msd,OI20 |
Uniprot Accession | Q14696 |
Uniprot Entry Name | MESD_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000117899 |
Target Classification | Not Available |
Predicted to enable low-density lipoprotein particle receptor binding activity. Involved in ossification and protein folding. Located in endoplasmic reticulum. Implicated in osteogenesis imperfecta type 20. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.