Human IL11/AGIF/ IL-11ORF/cDNA clone-Lentivirus particle (NM_000641)
SKU: vGMLP003437
Size: 10 µg
Leading Time: 3-7 working days
Pre-made Human IL11/AGIF/ IL-11 Lentiviral expression plasmid for IL11 lentivirus packaging, IL11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL11/AGIF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003437 | Human IL11 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003437 |
Gene Name | IL11 |
Accession Number | NM_000641 |
Gene ID | 3589 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 600 bp |
Gene Alias | AGIF, IL-11 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACTGTGTTTGCCGCCTGGTCCTGGTCGTGCTGAGCCTGTGGCCAGATACAGCTGTCGCCCCTGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCCTCGGGCCGAGCTGGACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCAGCTGGCTGCACAGCTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCTGCCCACCCTGGCCATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACAAGGCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTCCCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCGCCGGCTGCAGCTCCTGATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGCGCCCCCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCACGCCATCCTGGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCGGCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T56308-Ab | Anti-IL11/ AGIF/ IL-11 functional antibody |
Target Antigen | GM-Tg-g-T56308-Ag | IL11 protein |
Cytokine | cks-Tg-g-GM-T56308 | interleukin 11 (IL11) protein & antibody |
ORF Viral Vector | pGMLP003437 | Human IL11 Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-014 | Human IL11 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-097 | Human IL11 Adenovirus plasmid |
ORF Viral Vector | vGMLP003437 | Human IL11 Lentivirus particle |
ORF Viral Vector | vGMLP-IL-014 | Human IL11 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-097 | Human IL11 Adenovirus particle |
Target information
Target ID | GM-T56308 |
Target Name | IL11 |
Gene ID | 3589, 16156, 722817, 171040, 101085086, 611309, 100337295, 100056037 |
Gene Symbol and Synonyms | AGIF,IL-11,IL11 |
Uniprot Accession | P20809 |
Uniprot Entry Name | IL11_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000095752 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.