Human IL11/AGIF/ IL-11ORF/cDNA clone-Lentivirus particle (NM_000641)

SKU: vGMLP-IL-014
Size: 10 µg
Leading Time: 3-7 working days

Pre-made Human IL11/AGIF/ IL-11 Lentiviral expression plasmid for IL11 lentivirus packaging, IL11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to IL11/AGIF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP-IL-014 Human IL11 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP-IL-014
Gene Name IL11
Accession Number NM_000641
Gene ID 3589
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 600 bp
Gene Alias AGIF, IL-11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACTGTGTTTGCCGCCTGGTCCTGGTCGTGCTGAGCCTGTGGCCAGATACAGCTGTCGCCCCTGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCCTCGGGCCGAGCTGGACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCAGCTGGCTGCACAGCTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCTGCCCACCCTGGCCATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACAAGGCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTCCCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCGCCGGCTGCAGCTCCTGATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGCGCCCCCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCACGCCATCCTGGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCGGCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T56308-Ab Anti-IL11/ AGIF/ IL-11 functional antibody
    Target Antigen GM-Tg-g-T56308-Ag IL11 protein
    Cytokine cks-Tg-g-GM-T56308 interleukin 11 (IL11) protein & antibody
    ORF Viral Vector pGMLP003437 Human IL11 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-014 Human IL11 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-097 Human IL11 Adenovirus plasmid
    ORF Viral Vector vGMLP003437 Human IL11 Lentivirus particle
    ORF Viral Vector vGMLP-IL-014 Human IL11 Lentivirus particle
    ORF Viral Vector vGMAP-IL-097 Human IL11 Adenovirus particle


    Target information

    Target ID GM-T56308
    Target Name IL11
    Gene ID 3589, 16156, 722817, 171040, 101085086, 611309, 100337295, 100056037
    Gene Symbol and Synonyms AGIF,IL-11,IL11
    Uniprot Accession P20809
    Uniprot Entry Name IL11_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000095752
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.