Human FFAR4/BMIQ10/ GPR120 ORF/cDNA clone-Lentivirus particle (NM_181745)

Pre-made Human FFAR4/BMIQ10/ GPR120 Lentiviral expression plasmid for FFAR4 lentivirus packaging, FFAR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to GPR120/FFAR4/BMIQ10 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003156 Human FFAR4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003156
Gene Name FFAR4
Accession Number NM_181745
Gene ID 338557
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1134 bp
Gene Alias BMIQ10, GPR120, GPR129, GT01, O3FAR1, PGR4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCCCTGAATGCGCGCGGGCAGCGGGCGACGCGCCCTTGCGCAGCCTGGAGCAAGCCAACCGCACCCGCTTTCCCTTCTTCTCCGACGTCAAGGGCGACCACCGGCTGGTGCTGGCCGCGGTGGAGACAACCGTGCTGGTGCTCATCTTTGCAGTGTCGCTGCTGGGCAACGTGTGCGCCCTGGTGCTGGTGGCGCGCCGACGACGCCGCGGCGCGACTGCCTGCCTGGTACTCAACCTCTTCTGCGCGGACCTGCTCTTCATCAGCGCTATCCCTCTGGTGCTGGCCGTGCGCTGGACTGAGGCCTGGCTGCTGGGCCCCGTTGCCTGCCACCTGCTCTTCTACGTGATGACCCTGAGCGGCAGCGTCACCATCCTCACGCTGGCCGCGGTCAGCCTGGAGCGCATGGTGTGCATCGTGCACCTGCAGCGCGGCGTGCGGGGTCCTGGGCGGCGGGCGCGGGCAGTGCTGCTGGCGCTCATCTGGGGCTATTCGGCGGTCGCCGCTCTGCCTCTCTGCGTCTTCTTCCGAGTCGTCCCGCAACGGCTCCCCGGCGCCGACCAGGAAATTTCGATTTGCACACTGATTTGGCCCACCATTCCTGGAGAGATCTCGTGGGATGTCTCTTTTGTTACTTTGAACTTCTTGGTGCCAGGACTGGTCATTGTGATCAGTTACTCCAAAATTTTACAGACCTCGGAACACCTCCTGGATGCAAGAGCTGTCGTGACTCACAGTGAGATCACAAAGGCATCAAGGAAGAGGCTCACGGTAAGCCTGGCCTACTCGGAGAGCCACCAGATCCGCGTGTCCCAGCAGGACTTCCGGCTCTTCCGCACCCTCTTCCTCCTCATGGTCTCCTTCTTCATCATGTGGAGCCCCATCATCATCACCATCCTCCTCATCCTGATCCAGAACTTCAAGCAAGACCTGGTCATCTGGCCGTCCCTCTTCTTCTGGGTGGTGGCCTTCACATTTGCTAATTCAGCCCTAAACCCCATCCTCTACAACATGACACTGTGCAGGAATGAGTGGAAGAAAATTTTTTGCTGCTTCTGGTTCCCAGAAAAGGGAGCCATTTTAACAGACACATCTGTCAAAAGAAATGACTTGTCGATTATTTCTGGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51385-Ab Anti-FFAR4/ GPR120/ BMIQ10 monoclonal antibody
    Target Antigen GM-Tg-g-T51385-Ag GPR120/FFAR4 VLP (virus-like particle)
    ORF Viral Vector pGMLV000363 Human FFAR4 Lentivirus plasmid
    ORF Viral Vector pGMLP003156 Human FFAR4 Lentivirus plasmid
    ORF Viral Vector vGMLV000363 Human FFAR4 Lentivirus particle
    ORF Viral Vector vGMLP003156 Human FFAR4 Lentivirus particle


    Target information

    Target ID GM-T51385
    Target Name GPR120
    Gene ID 338557, 107221, 700014, 294075, 101087526, 477774, 533266
    Gene Symbol and Synonyms BMIQ10,Ffa4,FFAR4,GPR120,GPR129,GT01,KPG_013,O3FAR1,OB10Q,PGR4
    Uniprot Accession Q5NUL3
    Uniprot Entry Name FFAR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000186188
    Target Classification GPCR

    This gene encodes a G protein-coupled receptor (GPR) which belongs to the rhodopsin family of GPRs. The encoded protein functions as a receptor for free fatty acids, including omega-3, and participates in suppressing anti-inflammatory responses and insulin sensitizing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.