Human FFAR4/BMIQ10/ GPR120 ORF/cDNA clone-Lentivirus plasmid (NM_181745)
Pre-made Human FFAR4/BMIQ10/ GPR120 Lentiviral expression plasmid for FFAR4 lentivirus packaging, FFAR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GPR120/FFAR4/BMIQ10 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003156 | Human FFAR4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003156 |
Gene Name | FFAR4 |
Accession Number | NM_181745 |
Gene ID | 338557 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1134 bp |
Gene Alias | BMIQ10, GPR120, GPR129, GT01, O3FAR1, PGR4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCCCTGAATGCGCGCGGGCAGCGGGCGACGCGCCCTTGCGCAGCCTGGAGCAAGCCAACCGCACCCGCTTTCCCTTCTTCTCCGACGTCAAGGGCGACCACCGGCTGGTGCTGGCCGCGGTGGAGACAACCGTGCTGGTGCTCATCTTTGCAGTGTCGCTGCTGGGCAACGTGTGCGCCCTGGTGCTGGTGGCGCGCCGACGACGCCGCGGCGCGACTGCCTGCCTGGTACTCAACCTCTTCTGCGCGGACCTGCTCTTCATCAGCGCTATCCCTCTGGTGCTGGCCGTGCGCTGGACTGAGGCCTGGCTGCTGGGCCCCGTTGCCTGCCACCTGCTCTTCTACGTGATGACCCTGAGCGGCAGCGTCACCATCCTCACGCTGGCCGCGGTCAGCCTGGAGCGCATGGTGTGCATCGTGCACCTGCAGCGCGGCGTGCGGGGTCCTGGGCGGCGGGCGCGGGCAGTGCTGCTGGCGCTCATCTGGGGCTATTCGGCGGTCGCCGCTCTGCCTCTCTGCGTCTTCTTCCGAGTCGTCCCGCAACGGCTCCCCGGCGCCGACCAGGAAATTTCGATTTGCACACTGATTTGGCCCACCATTCCTGGAGAGATCTCGTGGGATGTCTCTTTTGTTACTTTGAACTTCTTGGTGCCAGGACTGGTCATTGTGATCAGTTACTCCAAAATTTTACAGACCTCGGAACACCTCCTGGATGCAAGAGCTGTCGTGACTCACAGTGAGATCACAAAGGCATCAAGGAAGAGGCTCACGGTAAGCCTGGCCTACTCGGAGAGCCACCAGATCCGCGTGTCCCAGCAGGACTTCCGGCTCTTCCGCACCCTCTTCCTCCTCATGGTCTCCTTCTTCATCATGTGGAGCCCCATCATCATCACCATCCTCCTCATCCTGATCCAGAACTTCAAGCAAGACCTGGTCATCTGGCCGTCCCTCTTCTTCTGGGTGGTGGCCTTCACATTTGCTAATTCAGCCCTAAACCCCATCCTCTACAACATGACACTGTGCAGGAATGAGTGGAAGAAAATTTTTTGCTGCTTCTGGTTCCCAGAAAAGGGAGCCATTTTAACAGACACATCTGTCAAAAGAAATGACTTGTCGATTATTTCTGGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T51385-Ab | Anti-FFAR4/ GPR120/ BMIQ10 monoclonal antibody |
Target Antigen | GM-Tg-g-T51385-Ag | GPR120/FFAR4 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000363 | Human FFAR4 Lentivirus plasmid |
ORF Viral Vector | pGMLP003156 | Human FFAR4 Lentivirus plasmid |
ORF Viral Vector | vGMLV000363 | Human FFAR4 Lentivirus particle |
ORF Viral Vector | vGMLP003156 | Human FFAR4 Lentivirus particle |
Target information
Target ID | GM-T51385 |
Target Name | GPR120 |
Gene ID | 338557, 107221, 700014, 294075, 101087526, 477774, 533266 |
Gene Symbol and Synonyms | BMIQ10,Ffa4,FFAR4,GPR120,GPR129,GT01,KPG_013,O3FAR1,OB10Q,PGR4 |
Uniprot Accession | Q5NUL3 |
Uniprot Entry Name | FFAR4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000186188 |
Target Classification | GPCR |
This gene encodes a G protein-coupled receptor (GPR) which belongs to the rhodopsin family of GPRs. The encoded protein functions as a receptor for free fatty acids, including omega-3, and participates in suppressing anti-inflammatory responses and insulin sensitizing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.