Human RPL15/DBA12/ EC45 ORF/cDNA clone-Lentivirus particle (NM_002948)
Pre-made Human RPL15/DBA12/ EC45 Lentiviral expression plasmid for RPL15 lentivirus packaging, RPL15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RPL15/DBA12 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003155 | Human RPL15 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003155 |
Gene Name | RPL15 |
Accession Number | NM_002948 |
Gene ID | 6138 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 615 bp |
Gene Alias | DBA12, EC45, L15, RPL10, RPLY10, RPYL10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGCTTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCCCGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTTATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACTTACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCCGTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGGGTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAAGCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAGATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTCCACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTCCACCGTTACCGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T73230-Ab | Anti-RPL15 monoclonal antibody |
Target Antigen | GM-Tg-g-T73230-Ag | RPL15 protein |
ORF Viral Vector | pGMLV000358 | Human RPL15 Lentivirus plasmid |
ORF Viral Vector | pGMPC000783 | Human RPL15 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003155 | Human RPL15 Lentivirus plasmid |
ORF Viral Vector | pGMAP000374 | Human RPL15 Adenovirus plasmid |
ORF Viral Vector | vGMLV000358 | Human RPL15 Lentivirus particle |
ORF Viral Vector | vGMLP003155 | Human RPL15 Lentivirus particle |
ORF Viral Vector | vGMAP000374 | Human RPL15 Adenovirus particle |
Target information
Target ID | GM-T73230 |
Target Name | RPL15 |
Gene ID | 6138, 66480, 701255, 245981, 101083198, 477046, 507151, 100051688 |
Gene Symbol and Synonyms | 2510008H07Rik,DBA12,EC45,eL15,L15,RPL10,RPL15,RPLY10,RPYL10 |
Uniprot Accession | P61313 |
Uniprot Entry Name | RL15_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000174748 |
Target Classification | Not Available |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L15E family of ribosomal proteins and a component of the 60S subunit. This gene shares sequence similarity with the yeast ribosomal protein YL10 gene. Elevated expression of this gene has been observed in esophageal tumors and gastric cancer tissues, and deletion of this gene has been observed in a Diamond-Blackfan anemia (DBA) patient. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Mar 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.