Human RPL15/DBA12/ EC45 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001253382.2)

Pre-made Human RPL15/DBA12/ EC45 Non-Viral expression plasmid (overexpression vector) for mouse RPL15 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to RPL15/DBA12 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000783 Human RPL15 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000783
Gene Name RPL15
Accession Number NM_001253382.2
Gene ID 6138
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 615 bp
Gene Alias DBA12, EC45, L15, RPL10, RPLY10, RPYL10
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGCTTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCCCGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTTATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACTTACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCCGTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGGGTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAAGCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAGATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTCCACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTCCACCGTTACCGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T73230-Ab Anti-RPL15 monoclonal antibody
    Target Antigen GM-Tg-g-T73230-Ag RPL15 protein
    ORF Viral Vector pGMLV000358 Human RPL15 Lentivirus plasmid
    ORF Viral Vector pGMPC000783 Human RPL15 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003155 Human RPL15 Lentivirus plasmid
    ORF Viral Vector pGMAP000374 Human RPL15 Adenovirus plasmid
    ORF Viral Vector vGMLV000358 Human RPL15 Lentivirus particle
    ORF Viral Vector vGMLP003155 Human RPL15 Lentivirus particle
    ORF Viral Vector vGMAP000374 Human RPL15 Adenovirus particle


    Target information

    Target ID GM-T73230
    Target Name RPL15
    Gene ID 6138, 66480, 701255, 245981, 101083198, 477046, 507151, 100051688
    Gene Symbol and Synonyms 2510008H07Rik,DBA12,EC45,eL15,L15,RPL10,RPL15,RPLY10,RPYL10
    Uniprot Accession P61313
    Uniprot Entry Name RL15_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000174748
    Target Classification Not Available

    Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L15E family of ribosomal proteins and a component of the 60S subunit. This gene shares sequence similarity with the yeast ribosomal protein YL10 gene. Elevated expression of this gene has been observed in esophageal tumors and gastric cancer tissues, and deletion of this gene has been observed in a Diamond-Blackfan anemia (DBA) patient. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Mar 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.