Human CXCL9/CMK/crg-10 ORF/cDNA clone-Lentivirus particle (NM_002416)

SKU: vGMLP002749
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CXCL9/CMK/crg-10 Lentiviral expression plasmid for CXCL9 lentivirus packaging, CXCL9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CXCL9/CMK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002749 Human CXCL9 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002749
Gene Name CXCL9
Accession Number NM_002416
Gene ID 4283
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 378 bp
Gene Alias CMK,crg-10,Humig,MIG,SCYB9
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGAAAAGTGGTGTTCTTTTCCTCTTGGGCATCATCTTGCTGGTTCTGATTGGAGTGCAAGGAACCCCAGTAGTGAGAAAGGGTCGCTGTTCCTGCATCAGCACCAACCAAGGGACTATCCACCTACAATCCTTGAAAGACCTTAAACAATTTGCCCCAAGCCCTTCCTGCGAGAAAATTGAAATCATTGCTACACTGAAGAATGGAGTTCAAACATGTCTAAACCCAGATTCAGCAGATGTGAAGGAACTGATTAAAAAGTGGGAGAAACAGGTCAGCCAAAAGAAAAAGCAAAAGAATGGGAAAAAACATCAAAAAAAGAAAGTTCTGAAAGTTCGAAAATCTCAACGTTCTCGTCAAAAGAAGACTACATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T56349-Ab Anti-CXCL9/ CMK/ Humig functional antibody
    Target Antigen GM-Tg-g-T56349-Ag CXCL9 protein
    Cytokine cks-Tg-g-GM-T56349 chemokine (C-X-C motif) ligand 9 (CXCL9) protein & antibody
    ORF Viral Vector pGMLP002749 Human CXCL9 Lentivirus plasmid
    ORF Viral Vector pGMPC001262 Human CXCL9 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002749 Human CXCL9 Lentivirus particle


    Target information

    Target ID GM-T56349
    Target Name CXCL9
    Gene ID 4283, 17329, 574336, 246759, 101100388, 513990, 100057927
    Gene Symbol and Synonyms CMK,crg-10,CXCL9,Humig,MIG,MuMIG,SCYB9
    Uniprot Accession Q07325
    Uniprot Entry Name CXCL9_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Hyperacute Allograft Rejection, Complications of kidney transplant, Kidney transplant rejection
    Gene Ensembl ENSG00000138755
    Target Classification Checkpoint-Immuno Oncology

    This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded is thought to be involved in T cell trafficking. The encoded protein binds to C-X-C motif chemokine 3 and is a chemoattractant for lymphocytes but not for neutrophils. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.