Human CCL22/A-152E5.1/ABCD-1 ORF/cDNA clone-Lentivirus particle (NM_002990)

Cat. No.: vGMLP002730

Pre-made Human CCL22/A-152E5.1/ABCD-1 Lentiviral expression plasmid for CCL22 lentivirus packaging, CCL22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MDC/CCL22/A-152E5.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002730 Human CCL22 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002730
Gene Name CCL22
Accession Number NM_002990
Gene ID 6367
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 282 bp
Gene Alias A-152E5.1,ABCD-1,DC/B-CK,MDC,SCYA22,STCP-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCGCCTACAGACTGCACTCCTGGTTGTCCTCGTCCTCCTTGCTGTGGCGCTTCAAGCAACTGAGGCAGGCCCCTACGGCGCCAACATGGAAGACAGCGTCTGCTGCCGTGATTACGTCCGTTACCGTCTGCCCCTGCGCGTGGTGAAACACTTCTACTGGACCTCAGACTCCTGCCCGAGGCCTGGCGTGGTGTTGCTAACCTTCAGGGATAAGGAGATCTGTGCCGATCCCAGAGTGCCCTGGGTGAAGATGATTCTCAATAAGCTGAGCCAATGA
ORF Protein Sequence MDRLQTALLVVLVLLAVALQATEAGPYGANMEDSVCCRDYVRYRLPLRVVKHFYWTSDSCPRPGVVLLTFRDKEICADPRVPWVKMILNKLSQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22117-Ab Anti-CCL22/ MDC/ A-152E5.1 functional antibody
    Target Antigen GM-Tg-g-T22117-Ag MDC/CCL22 protein
    Cytokine cks-Tg-g-GM-T22117 chemokine (C-C motif) ligand 22 (CCL22) protein & antibody
    ORF Viral Vector pGMLP002730 Human CCL22 Lentivirus plasmid
    ORF Viral Vector vGMLP002730 Human CCL22 Lentivirus particle


    Target information

    Target ID GM-T22117
    Target Name MDC
    Gene ID 6367, 20299, 100428046, 117551, 101091326, 100686212, 616996, 100062332
    Gene Symbol and Synonyms A-152E5.1,ABCD-1,CCL22,DC/B-CK,DCBCK,MDC,SCYA22,STCP-1
    Uniprot Accession O00626
    Uniprot Entry Name CCL22_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000102962
    Target Classification Not Available

    This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. The product of this gene binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated T lymphocytes to inflammatory sites and other aspects of activated T lymphocyte physiology. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.