Human CCL22/A-152E5.1/ ABCD-1 ORF/cDNA clone-Lentivirus plasmid (NM_002990)
Pre-made Human CCL22/A-152E5.1/ ABCD-1 Lentiviral expression plasmid for CCL22 lentivirus packaging, CCL22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MDC/CCL22/A-152E5.1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002730 | Human CCL22 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002730 |
Gene Name | CCL22 |
Accession Number | NM_002990 |
Gene ID | 6367 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 282 bp |
Gene Alias | A-152E5.1, ABCD-1, DC/B-CK, MDC, SCYA22, STCP-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATCGCCTACAGACTGCACTCCTGGTTGTCCTCGTCCTCCTTGCTGTGGCGCTTCAAGCAACTGAGGCAGGCCCCTACGGCGCCAACATGGAAGACAGCGTCTGCTGCCGTGATTACGTCCGTTACCGTCTGCCCCTGCGCGTGGTGAAACACTTCTACTGGACCTCAGACTCCTGCCCGAGGCCTGGCGTGGTGTTGCTAACCTTCAGGGATAAGGAGATCTGTGCCGATCCCAGAGTGCCCTGGGTGAAGATGATTCTCAATAAGCTGAGCCAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T22117-Ab | Anti-CCL22/ MDC/ A-152E5.1 functional antibody |
Target Antigen | GM-Tg-g-T22117-Ag | MDC/CCL22 protein |
Cytokine | cks-Tg-g-GM-T22117 | chemokine (C-C motif) ligand 22 (CCL22) protein & antibody |
ORF Viral Vector | pGMLP002730 | Human CCL22 Lentivirus plasmid |
ORF Viral Vector | vGMLP002730 | Human CCL22 Lentivirus particle |
Target information
Target ID | GM-T22117 |
Target Name | MDC |
Gene ID | 6367, 20299, 100428046, 117551, 101091326, 100686212, 616996, 100062332 |
Gene Symbol and Synonyms | A-152E5.1,ABCD-1,CCL22,DC/B-CK,DCBCK,MDC,SCYA22,STCP-1 |
Uniprot Accession | O00626 |
Uniprot Entry Name | CCL22_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000102962 |
Target Classification | Not Available |
This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. The product of this gene binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated T lymphocytes to inflammatory sites and other aspects of activated T lymphocyte physiology. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.