Human DPYD/DHP/DHPDHASE ORF/cDNA clone-Lentivirus particle (NM_001160301)
Cat. No.: vGMLP002087
Pre-made Human DPYD/DHP/DHPDHASE Lentiviral expression plasmid for DPYD lentivirus packaging, DPYD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
DPYD/DHP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002087 | Human DPYD Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002087 |
Gene Name | DPYD |
Accession Number | NM_001160301 |
Gene ID | 1806 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 522 bp |
Gene Alias | DHP,DHPDHASE,DPD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCCCTGTGCTCAGTAAGGACTCGGCGGACATCGAGAGTATCCTGGCTTTAAATCCTCGAACACAAACTCATGCAACTCTGTGTTCCACTTCGGCCAAGAAATTAGACAAGAAACATTGGAAAAGAAATCCTGATAAGAACTGCTTTAATTGTGAGAAGCTGGAGAATAATTTTGATGACATCAAGCACACGACTCTTGGTGAGCGAGGAGCTCTCCGAGAAGCAATGAGATGCCTGAAATGTGCAGATGCCCCGTGTCAGAAGAGCTGTCCAACTAATCTTGATATTAAATCATTCATCACAAGTATTGCAAACAAGAACTATTATGGAGCTGCTAAGATGATATTTTCTGACAACCCACTTGGTCTGACTTGTGGAATGGTATGTCCAACCTCTGATCTTTGTGTAGGTGGATGCAATTTATATGCCACTGAAGAGGGACCCATTAATATTGGTGGATTGCAGCAATTTGCTACTGAGACTTTGATCCTGGCTTTCTCTTTAATGAATCATTTGTAA |
ORF Protein Sequence | MAPVLSKDSADIESILALNPRTQTHATLCSTSAKKLDKKHWKRNPDKNCFNCEKLENNFDDIKHTTLGERGALREAMRCLKCADAPCQKSCPTNLDIKSFITSIANKNYYGAAKMIFSDNPLGLTCGMVCPTSDLCVGGCNLYATEEGPINIGGLQQFATETLILAFSLMNHL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T75890-Ab | Anti-DPYD monoclonal antibody |
Target Antigen | GM-Tg-g-T75890-Ag | DPYD protein |
ORF Viral Vector | pGMLP002087 | Human DPYD Lentivirus plasmid |
ORF Viral Vector | pGMLV001495 | Human DPYD Lentivirus plasmid |
ORF Viral Vector | vGMLP002087 | Human DPYD Lentivirus particle |
ORF Viral Vector | vGMLV001495 | Human DPYD Lentivirus particle |
Target information
Target ID | GM-T75890 |
Target Name | DPYD |
Gene ID | 1806, 99586, 715672, 81656, 101084380, 479935, 281124, 100057177 |
Gene Symbol and Synonyms | DHP,DHPDHASE,DPD,DPYD,DYPD,E330028L06Rik |
Uniprot Accession | Q12882 |
Uniprot Entry Name | DPYD_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000188641 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.