Human DPYD/DHP/DHPDHASE ORF/cDNA clone-Lentivirus plasmid (NM_001160301)

Cat. No.: pGMLP002087
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DPYD/DHP/DHPDHASE Lentiviral expression plasmid for DPYD lentivirus packaging, DPYD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to DPYD/DHP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $430.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002087
Gene Name DPYD
Accession Number NM_001160301
Gene ID 1806
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 522 bp
Gene Alias DHP,DHPDHASE,DPD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCCTGTGCTCAGTAAGGACTCGGCGGACATCGAGAGTATCCTGGCTTTAAATCCTCGAACACAAACTCATGCAACTCTGTGTTCCACTTCGGCCAAGAAATTAGACAAGAAACATTGGAAAAGAAATCCTGATAAGAACTGCTTTAATTGTGAGAAGCTGGAGAATAATTTTGATGACATCAAGCACACGACTCTTGGTGAGCGAGGAGCTCTCCGAGAAGCAATGAGATGCCTGAAATGTGCAGATGCCCCGTGTCAGAAGAGCTGTCCAACTAATCTTGATATTAAATCATTCATCACAAGTATTGCAAACAAGAACTATTATGGAGCTGCTAAGATGATATTTTCTGACAACCCACTTGGTCTGACTTGTGGAATGGTATGTCCAACCTCTGATCTTTGTGTAGGTGGATGCAATTTATATGCCACTGAAGAGGGACCCATTAATATTGGTGGATTGCAGCAATTTGCTACTGAGACTTTGATCCTGGCTTTCTCTTTAATGAATCATTTGTAA
ORF Protein Sequence MAPVLSKDSADIESILALNPRTQTHATLCSTSAKKLDKKHWKRNPDKNCFNCEKLENNFDDIKHTTLGERGALREAMRCLKCADAPCQKSCPTNLDIKSFITSIANKNYYGAAKMIFSDNPLGLTCGMVCPTSDLCVGGCNLYATEEGPINIGGLQQFATETLILAFSLMNHL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T75890-Ab Anti-DPYD monoclonal antibody
    Target Antigen GM-Tg-g-T75890-Ag DPYD protein
    ORF Viral Vector pGMLP002087 Human DPYD Lentivirus plasmid
    ORF Viral Vector pGMLV001495 Human DPYD Lentivirus plasmid
    ORF Viral Vector vGMLP002087 Human DPYD Lentivirus particle
    ORF Viral Vector vGMLV001495 Human DPYD Lentivirus particle


    Target information

    Target ID GM-T75890
    Target Name DPYD
    Gene ID 1806, 99586, 715672, 81656, 101084380, 479935, 281124, 100057177
    Gene Symbol and Synonyms DHP,DHPDHASE,DPD,DPYD,DYPD,E330028L06Rik
    Uniprot Accession Q12882
    Uniprot Entry Name DPYD_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000188641
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.