Human SMAD7/CRCS3/MADH7 ORF/cDNA clone-Lentivirus particle (NM_005904)

SKU: vGMLP001429
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SMAD7/CRCS3/MADH7 Lentiviral expression plasmid for SMAD7 lentivirus packaging, SMAD7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SMAD7/CRCS3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001429 Human SMAD7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001429
Gene Name SMAD7
Accession Number NM_005904
Gene ID 4092
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1281 bp
Gene Alias CRCS3,MADH7,MADH8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTCAGGACCAAACGATCTGCGCTCGTCCGGCGTCTCTGGAGGAGCCGTGCGCCCGGCGGCGAGGACGAGGAGGAGGGCGCAGGGGGAGGTGGAGGAGGAGGCGAGCTGCGGGGAGAAGGGGCGACGGACAGCCGAGCGCATGGGGCCGGTGGCGGCGGCCCGGGCAGGGCTGGATGCTGCCTGGGCAAGGCGGTGCGAGGTGCCAAAGGTCACCACCATCCCCACCCGCCAGCCGCGGGCGCCGGCGCGGCCGGGGGCGCCGAGGCGGATCTGAAGGCGCTCACGCACTCGGTGCTCAAGAAACTGAAGGAGCGGCAGCTGGAGCTGCTGCTCCAGGCCGTGGAGTCCCGCGGCGGGACGCGCACCGCGTGCCTCCTGCTGCCCGGCCGCCTGGACTGCAGGCTGGGCCCGGGGGCGCCCGCCGGCGCGCAGCCTGCGCAGCCGCCCTCGTCCTACTCGCTCCCCCTCCTGCTGTGCAAAGTGTTCAGGTGGCCGGATCTCAGGCATTCCTCGGAAGTCAAGAGGCTGTGTTGCTGTGAATCTTACGGGAAGATCAACCCCGAGCTGGTGTGCTGCAACCCCCATCACCTTAGCCGACTCTGCGAACTAGAGTCTCCCCCCCCTCCTTACTCCAGATACCCGATGGATTTTCTCAAACCAACTGCAGACTGTCCAGATGCTGTGCCTTCCTCCGCTGAAACAGGGGGAACGAATTATCTGGCCCCTGGGGGGCTTTCAGATTCCCAACTTCTTCTGGAGCCTGGGGATCGGTCACACTGGTGCGTGGTGGCATACTGGGAGGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAGCCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATGGCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCAGCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATCCAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGACAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTCCCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGTACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCAGCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTGTGAAGGGCTGGGGCCAGTGCTACACCCGCCAGTTCATCAGCAGCTGCCCGTGCTGGCTAGAGGTCATCTTCAACAGCCGGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T94695-Ab Anti-SMAD7 monoclonal antibody
    Target Antigen GM-Tg-g-T94695-Ag SMAD7 protein
    Cytokine cks-Tg-g-GM-T94695 SMAD family member 7 (SMAD7) protein & antibody
    ORF Viral Vector pGMLP001429 Human SMAD7 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-049 Human SMAD7 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-189 Human SMAD7 Adenovirus plasmid
    ORF Viral Vector pGMPC000433 Human SMAD7 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001429 Human SMAD7 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-049 Human SMAD7 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-189 Human SMAD7 Adenovirus particle


    Target information

    Target ID GM-T94695
    Target Name SMAD7
    Gene ID 4092, 17131, 698338, 81516, 101088277, 490570, 535916, 100033853
    Gene Symbol and Synonyms CRCS3,MADH7,MADH8,SMAD7
    Uniprot Accession O15105
    Uniprot Entry Name SMAD7_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000101665
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a nuclear protein that binds the E3 ubiquitin ligase SMURF2. Upon binding, this complex translocates to the cytoplasm, where it interacts with TGF-beta receptor type-1 (TGFBR1), leading to the degradation of both the encoded protein and TGFBR1. Expression of this gene is induced by TGFBR1. Variations in this gene are a cause of susceptibility to colorectal cancer type 3 (CRCS3). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.