Human EMP3/YMP ORF/cDNA clone-Lentivirus particle (NM_001425)
Pre-made Human EMP3/YMP Lentiviral expression plasmid for EMP3 lentivirus packaging, EMP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to EMP3/YMP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001223 | Human EMP3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001223 |
Gene Name | EMP3 |
Accession Number | NM_001425 |
Gene ID | 2014 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 492 bp |
Gene Alias | YMP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCACTCCTCTTGCTGGTGGTCTCAGCCCTTCACATCCTCATTCTTATACTGCTTTTCGTGGCCACTTTGGACAAGTCCTGGTGGACTCTCCCTGGGAAAGAGTCCCTGAATCTCTGGTACGACTGCACGTGGAACAACGACACCAAAACATGGGCCTGCAGTAATGTCAGCGAGAATGGCTGGCTGAAGGCGGTGCAGGTCCTCATGGTGCTCTCCCTCATTCTCTGCTGTCTCTCCTTCATCCTGTTCATGTTCCAGCTCTACACCATGCGACGAGGAGGTCTCTTCTATGCCACCGGCCTCTGCCAGCTTTGCACCAGCGTGGCGGTGTTTACTGGCGCCTTGATCTATGCCATTCACGCCGAGGAGATCCTGGAGAAGCACCCGCGAGGGGGCAGCTTCGGATACTGCTTCGCCCTGGCCTGGGTGGCCTTCCCCCTCGCCCTGGTCAGCGGCATCATCTACATCCACCTACGGAAGCGGGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0405-Ab | Anti-EMP3/ YMP monoclonal antibody |
Target Antigen | GM-Tg-g-MP0405-Ag | EMP3 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000327 | Human EMP3 Lentivirus plasmid |
ORF Viral Vector | pGMLP001223 | Human EMP3 Lentivirus plasmid |
ORF Viral Vector | vGMLV000327 | Human EMP3 Lentivirus particle |
ORF Viral Vector | vGMLP001223 | Human EMP3 Lentivirus particle |
Target information
Target ID | GM-MP0405 |
Target Name | EMP3 |
Gene ID | 2014, 13732, 717867, 81505, 101088446, 484408, 535273, 100050794 |
Gene Symbol and Synonyms | EMP3,H-4,H4,HNMP-1,MI-35,YMP |
Uniprot Accession | P54852 |
Uniprot Entry Name | EMP3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000142227 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the PMP-22/EMP/MP20 family of proteins. The protein contains four transmembrane domains and two N-linked glycosylation sites. It is thought to be involved in cell proliferation, cell-cell interactions and function as a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.