Human TNFRSF18/AITR/CD357 ORF/cDNA clone-Lentivirus particle (NM_004195)

Cat. No.: vGMLP000991

Pre-made Human TNFRSF18/AITR/CD357 Lentiviral expression plasmid for TNFRSF18 lentivirus packaging, TNFRSF18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TNFRSF18/AITR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000991 Human TNFRSF18 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000991
Gene Name TNFRSF18
Accession Number NM_004195
Gene ID 8784
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 726 bp
Gene Alias AITR,CD357,GITR,GITR-D
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCACAGCACGGGGCGATGGGCGCGTTTCGGGCCCTGTGCGGCCTGGCGCTGCTGTGCGCGCTCAGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCCCTGGGCGCCTCCTGCTTGGGACGGGAACGGACGCGCGCTGCTGCCGGGTTCACACGACGCGCTGCTGCCGCGATTACCCGGGCGAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGCCTGAATTCCACTGCGGAGACCCTTGCTGCACGACCTGCCGGCACCACCCTTGTCCCCCAGGCCAGGGGGTACAGTCCCAGGGGAAATTCAGTTTTGGCTTCCAGTGTATCGACTGTGCCTCGGGGACCTTCTCCGGGGGCCACGAAGGCCACTGCAAACCTTGGACAGACTGCACCCAGTTCGGGTTTCTCACTGTGTTCCCTGGGAACAAGACCCACAACGCTGTGTGCGTCCCAGGGTCCCCGCCGGCAGAGCCGCTTGGGTGGCTGACCGTCGTCCTCCTGGCCGTGGCCGCCTGCGTCCTCCTCCTGACCTCGGCCCAGCTTGGACTGCACATCTGGCAGCTGAGGAGTCAGTGCATGTGGCCCCGAGAGACCCAGCTGCTGCTGGAGGTGCCGCCGTCGACCGAAGACGCCAGAAGCTGCCAGTTCCCCGAGGAAGAGCGGGGCGAGCGATCGGCAGAGGAGAAGGGGCGGCTGGGAGACCTGTGGGTGTGA
ORF Protein Sequence MAQHGAMGAFRALCGLALLCALSLGQRPTGGPGCGPGRLLLGTGTDARCCRVHTTRCCRDYPGEECCSEWDCMCVQPEFHCGDPCCTTCRHHPCPPGQGVQSQGKFSFGFQCIDCASGTFSGGHEGHCKPWTDCTQFGFLTVFPGNKTHNAVCVPGSPPAEPLGWLTVVLLAVAACVLLLTSAQLGLHIWQLRSQCMWPRETQLLLEVPPSTEDARSCQFPEEERGERSAEEKGRLGDLWV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-466 Pre-Made Ragifilimab biosimilar, Whole mAb, Anti-TNFRSF18 Antibody: Anti-AITR/CD357/ENERGEN/GITR/GITR-D therapeutic antibody
    Biosimilar GMP-Bios-INN-810 Pre-Made Efaprinermin Alfa Biosimilar, Fusion Protein targeting TNFRSF18 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AITR/CD357/ENERGEN/GITR/GITR-D
    Biosimilar GMP-Bios-INN-815 Pre-Made Efgivanermin Alfa Biosimilar, Fusion Protein targeting TNFRSF18 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AITR/CD357/ENERGEN/GITR/GITR-D
    Target Antibody GM-Tg-g-T15344-Ab Anti-TNR18/ TNFRSF18/ AITR monoclonal antibody
    Target Antigen GM-Tg-g-T15344-Ag TNFRSF18 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T15344 tumor necrosis factor receptor superfamily, member 18 (TNFRSF18) protein & antibody
    ORF Viral Vector pGMLP000991 Human TNFRSF18 Lentivirus plasmid
    ORF Viral Vector vGMLP000991 Human TNFRSF18 Lentivirus particle


    Target information

    Target ID GM-T15344
    Target Name TNFRSF18
    Gene ID 8784, 21936, 699559, 500598, 101083251, 606971, 516256, 100066195
    Gene Symbol and Synonyms AITR,CD357,ENERGEN,GITR,GITR-D,TNFRSF18
    Uniprot Accession Q9Y5U5
    Uniprot Entry Name TNR18_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000186891
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the TNF-receptor superfamily. The encoded receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Feb 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.