Human CD79B/AGM6/ B29 ORF/cDNA clone-Lentivirus particle (NM_000626.3)
Pre-made Human CD79B/AGM6/ B29 Lentiviral expression plasmid for CD79B lentivirus packaging, CD79B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CD79B/AGM6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000751 | Human CD79B Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000751 |
Gene Name | CD79B |
Accession Number | NM_000626.3 |
Gene ID | 974 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 690 bp |
Gene Alias | AGM6, B29, IGB |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGCGTTGCTGCTGCTGCTCTCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGGTACCGGAATCCCAAAGGTAGTGCTTGTTCGCGGATCTGGCAGAGCCCACGTTTCATAGCCAGGAAACGGGGCTTCACGGTGAAAATGCACTGCTACATGAACAGCGCCTCCGGCAATGTGAGCTGGCTCTGGAAGCAGGAGATGGACGAGAATCCCCAGCAGCTGAAGCTGGAAAAGGGCCGCATGGAAGAGTCCCAGAACGAATCTCTCGCCACCCTCACCATCCAAGGCATCCGGTTTGAGGACAATGGCATCTACTTCTGTCAGCAGAAGTGCAACAACACCTCGGAGGTCTACCAGGGCTGCGGCACAGAGCTGCGAGTCATGGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAACACGCTGAAGGATGGTATCATCATGATCCAGACGCTGCTGATCATCCTCTTCATCATCGTGCCTATCTTCCTGCTGCTGGACAAGGATGACAGCAAGGCTGGCATGGAGGAAGATCACACCTACGAGGGCCTGGACATTGACCAGACAGCCACCTATGAGGACATAGTGACGCTGCGGACAGGGGAAGTGAAGTGGTCTGTAGGTGAGCACCCAGGCCAGGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-962 | Pre-Made Polatuzumab Vedotin Biosimilar, Whole Mab Adc, Anti-Cd79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody Drug Conjugate |
Biosimilar | GMP-Bios-INN-862 | Pre-Made Iladatuzumab Vedotin Biosimilar, Whole Mab Adc, Anti-Cd79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody Drug Conjugate |
Biosimilar | GMP-Bios-ab-264 | Pre-Made Iladatuzumab biosimilar, Whole mAb ADC, Anti-CD79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody |
Biosimilar | GMP-Bios-ab-449 | Pre-Made Polatuzumab biosimilar, Whole mAb ADC, Anti-CD79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody |
Target Antibody | GM-Tg-g-T08306-Ab | Anti-CD79B/ AGM6/ B29 monoclonal antibody |
Target Antigen | GM-Tg-g-T08306-Ag | CD79B VLP (virus-like particle) |
ORF Viral Vector | pGMLP000751 | Human CD79B Lentivirus plasmid |
ORF Viral Vector | vGMLP000751 | Human CD79B Lentivirus particle |
Target information
Target ID | GM-T08306 |
Target Name | CD79B |
Gene ID | 974, 15985, 718218, 171055, 101098098, 609449, 509801, 100064460 |
Gene Symbol and Synonyms | AGM6,B29,CD79B,Ig-beta,IGB,Igbeta |
Uniprot Accession | P40259 |
Uniprot Entry Name | CD79B_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000007312 |
Target Classification | Tumor-associated antigen (TAA) |
The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.