Human CD79B/AGM6/ B29 ORF/cDNA clone-Lentivirus plasmid (NM_000626.3)

Pre-made Human CD79B/AGM6/ B29 Lentiviral expression plasmid for CD79B lentivirus packaging, CD79B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CD79B/AGM6 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000751 Human CD79B Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000751
Gene Name CD79B
Accession Number NM_000626.3
Gene ID 974
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 690 bp
Gene Alias AGM6, B29, IGB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGCGTTGCTGCTGCTGCTCTCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGGTACCGGAATCCCAAAGGTAGTGCTTGTTCGCGGATCTGGCAGAGCCCACGTTTCATAGCCAGGAAACGGGGCTTCACGGTGAAAATGCACTGCTACATGAACAGCGCCTCCGGCAATGTGAGCTGGCTCTGGAAGCAGGAGATGGACGAGAATCCCCAGCAGCTGAAGCTGGAAAAGGGCCGCATGGAAGAGTCCCAGAACGAATCTCTCGCCACCCTCACCATCCAAGGCATCCGGTTTGAGGACAATGGCATCTACTTCTGTCAGCAGAAGTGCAACAACACCTCGGAGGTCTACCAGGGCTGCGGCACAGAGCTGCGAGTCATGGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAACACGCTGAAGGATGGTATCATCATGATCCAGACGCTGCTGATCATCCTCTTCATCATCGTGCCTATCTTCCTGCTGCTGGACAAGGATGACAGCAAGGCTGGCATGGAGGAAGATCACACCTACGAGGGCCTGGACATTGACCAGACAGCCACCTATGAGGACATAGTGACGCTGCGGACAGGGGAAGTGAAGTGGTCTGTAGGTGAGCACCCAGGCCAGGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-962 Pre-Made Polatuzumab Vedotin Biosimilar, Whole Mab Adc, Anti-Cd79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-INN-862 Pre-Made Iladatuzumab Vedotin Biosimilar, Whole Mab Adc, Anti-Cd79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-264 Pre-Made Iladatuzumab biosimilar, Whole mAb ADC, Anti-CD79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody
    Biosimilar GMP-Bios-ab-449 Pre-Made Polatuzumab biosimilar, Whole mAb ADC, Anti-CD79B Antibody: Anti-AGM6/B29/IGB therapeutic antibody
    Target Antibody GM-Tg-g-T08306-Ab Anti-CD79B/ AGM6/ B29 monoclonal antibody
    Target Antigen GM-Tg-g-T08306-Ag CD79B VLP (virus-like particle)
    ORF Viral Vector pGMLP000751 Human CD79B Lentivirus plasmid
    ORF Viral Vector vGMLP000751 Human CD79B Lentivirus particle


    Target information

    Target ID GM-T08306
    Target Name CD79B
    Gene ID 974, 15985, 718218, 171055, 101098098, 609449, 509801, 100064460
    Gene Symbol and Synonyms AGM6,B29,CD79B,Ig-beta,IGB,Igbeta
    Uniprot Accession P40259
    Uniprot Entry Name CD79B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000007312
    Target Classification Tumor-associated antigen (TAA)

    The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.