Human ADA ORF/cDNA clone-Lentivirus particle (NM_000022)

Cat. No.: vGMLP000474

Pre-made Human ADA/ Lentiviral expression plasmid for ADA lentivirus packaging, ADA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ADA/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000474 Human ADA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000474
Gene Name ADA
Accession Number NM_000022
Gene ID 100
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1092 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCAGACGCCCGCCTTCGACAAGCCCAAAGTGGAACTGCATGTCCACCTAGACGGATCCATCAAGCCTGAAACCATCTTATACTATGGCAGGAGGAGAGGGATCGCCCTCCCAGCTAACACAGCAGAGGGGCTGCTGAACGTCATTGGCATGGACAAGCCGCTCACCCTTCCAGACTTCCTGGCCAAGTTTGACTACTACATGCCTGCTATCGCGGGCTGCCGGGAGGCTATCAAAAGGATCGCCTATGAGTTTGTAGAGATGAAGGCCAAAGAGGGCGTGGTGTATGTGGAGGTGCGGTACAGTCCGCACCTGCTGGCCAACTCCAAAGTGGAGCCAATCCCCTGGAACCAGGCTGAAGGGGACCTCACCCCAGACGAGGTGGTGGCCCTAGTGGGCCAGGGCCTGCAGGAGGGGGAGCGAGACTTCGGGGTCAAGGCCCGGTCCATCCTGTGCTGCATGCGCCACCAGCCCAACTGGTCCCCCAAGGTGGTGGAGCTGTGTAAGAAGTACCAGCAGCAGACCGTGGTAGCCATTGACCTGGCTGGAGATGAGACCATCCCAGGAAGCAGCCTCTTGCCTGGACATGTCCAGGCCTACCAGGAGGCTGTGAAGAGCGGCATTCACCGTACTGTCCACGCCGGGGAGGTGGGCTCGGCCGAAGTAGTAAAAGAGGCTGTGGACATACTCAAGACAGAGCGGCTGGGACACGGCTACCACACCCTGGAAGACCAGGCCCTTTATAACAGGCTGCGGCAGGAAAACATGCACTTCGAGATCTGCCCCTGGTCCAGCTACCTCACTGGTGCCTGGAAGCCGGACACGGAGCATGCAGTCATTCGGCTCAAAAATGACCAGGCTAACTACTCGCTCAACACAGATGACCCGCTCATCTTCAAGTCCACCCTGGACACTGATTACCAGATGACCAAACGGGACATGGGCTTTACTGAAGAGGAGTTTAAAAGGCTGAACATCAATGCGGCCAAATCTAGTTTCCTCCCAGAAGATGAAAAGAGGGAGCTTCTCGACCTGCTCTATAAAGCCTATGGGATGCCACCTTCAGCCTCTGCAGGGCAGAACCTCTGA
ORF Protein Sequence MAQTPAFDKPKVELHVHLDGSIKPETILYYGRRRGIALPANTAEGLLNVIGMDKPLTLPDFLAKFDYYMPAIAGCREAIKRIAYEFVEMKAKEGVVYVEVRYSPHLLANSKVEPIPWNQAEGDLTPDEVVALVGQGLQEGERDFGVKARSILCCMRHQPNWSPKVVELCKKYQQQTVVAIDLAGDETIPGSSLLPGHVQAYQEAVKSGIHRTVHAGEVGSAEVVKEAVDILKTERLGHGYHTLEDQALYNRLRQENMHFEICPWSSYLTGAWKPDTEHAVIRLKNDQANYSLNTDDPLIFKSTLDTDYQMTKRDMGFTEEEFKRLNINAAKSSFLPEDEKRELLDLLYKAYGMPPSASAGQNL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T03661-Ab Anti-ADA monoclonal antibody
    Target Antigen GM-Tg-g-T03661-Ag ADA VLP (virus-like particle)
    ORF Viral Vector pGMLP000474 Human ADA Lentivirus plasmid
    ORF Viral Vector pGMAP000384 Human ADA Adenovirus plasmid
    ORF Viral Vector vGMLP000474 Human ADA Lentivirus particle
    ORF Viral Vector vGMAP000384 Human ADA Adenovirus particle


    Target information

    Target ID GM-T03661
    Target Name ADA
    Gene ID 100, 11486, 717897, 24165, 101090683, 477236, 280712, 100070773
    Gene Symbol and Synonyms ADA,ADA-like,ADA1
    Uniprot Accession P00813
    Uniprot Entry Name ADA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000196839
    Target Classification Not Available

    This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine in the purine catabolic pathway. Various mutations have been described for this gene and have been linked to human diseases related to impaired immune function such as severe combined immunodeficiency disease (SCID) which is the result of a deficiency in the ADA enzyme. In ADA-deficient individuals there is a marked depletion of T, B, and NK lymphocytes, and consequently, a lack of both humoral and cellular immunity. Conversely, elevated levels of this enzyme are associated with congenital hemolytic anemia. [provided by RefSeq, Sep 2019]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.