Human ADA ORF/cDNA clone-Lentivirus plasmid (NM_000022)
Cat. No.: pGMLP000474
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human ADA/ Lentiviral expression plasmid for ADA lentivirus packaging, ADA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
ADA/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000474 |
Gene Name | ADA |
Accession Number | NM_000022 |
Gene ID | 100 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1092 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCCAGACGCCCGCCTTCGACAAGCCCAAAGTGGAACTGCATGTCCACCTAGACGGATCCATCAAGCCTGAAACCATCTTATACTATGGCAGGAGGAGAGGGATCGCCCTCCCAGCTAACACAGCAGAGGGGCTGCTGAACGTCATTGGCATGGACAAGCCGCTCACCCTTCCAGACTTCCTGGCCAAGTTTGACTACTACATGCCTGCTATCGCGGGCTGCCGGGAGGCTATCAAAAGGATCGCCTATGAGTTTGTAGAGATGAAGGCCAAAGAGGGCGTGGTGTATGTGGAGGTGCGGTACAGTCCGCACCTGCTGGCCAACTCCAAAGTGGAGCCAATCCCCTGGAACCAGGCTGAAGGGGACCTCACCCCAGACGAGGTGGTGGCCCTAGTGGGCCAGGGCCTGCAGGAGGGGGAGCGAGACTTCGGGGTCAAGGCCCGGTCCATCCTGTGCTGCATGCGCCACCAGCCCAACTGGTCCCCCAAGGTGGTGGAGCTGTGTAAGAAGTACCAGCAGCAGACCGTGGTAGCCATTGACCTGGCTGGAGATGAGACCATCCCAGGAAGCAGCCTCTTGCCTGGACATGTCCAGGCCTACCAGGAGGCTGTGAAGAGCGGCATTCACCGTACTGTCCACGCCGGGGAGGTGGGCTCGGCCGAAGTAGTAAAAGAGGCTGTGGACATACTCAAGACAGAGCGGCTGGGACACGGCTACCACACCCTGGAAGACCAGGCCCTTTATAACAGGCTGCGGCAGGAAAACATGCACTTCGAGATCTGCCCCTGGTCCAGCTACCTCACTGGTGCCTGGAAGCCGGACACGGAGCATGCAGTCATTCGGCTCAAAAATGACCAGGCTAACTACTCGCTCAACACAGATGACCCGCTCATCTTCAAGTCCACCCTGGACACTGATTACCAGATGACCAAACGGGACATGGGCTTTACTGAAGAGGAGTTTAAAAGGCTGAACATCAATGCGGCCAAATCTAGTTTCCTCCCAGAAGATGAAAAGAGGGAGCTTCTCGACCTGCTCTATAAAGCCTATGGGATGCCACCTTCAGCCTCTGCAGGGCAGAACCTCTGA |
ORF Protein Sequence | MAQTPAFDKPKVELHVHLDGSIKPETILYYGRRRGIALPANTAEGLLNVIGMDKPLTLPDFLAKFDYYMPAIAGCREAIKRIAYEFVEMKAKEGVVYVEVRYSPHLLANSKVEPIPWNQAEGDLTPDEVVALVGQGLQEGERDFGVKARSILCCMRHQPNWSPKVVELCKKYQQQTVVAIDLAGDETIPGSSLLPGHVQAYQEAVKSGIHRTVHAGEVGSAEVVKEAVDILKTERLGHGYHTLEDQALYNRLRQENMHFEICPWSSYLTGAWKPDTEHAVIRLKNDQANYSLNTDDPLIFKSTLDTDYQMTKRDMGFTEEEFKRLNINAAKSSFLPEDEKRELLDLLYKAYGMPPSASAGQNL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T03661-Ab | Anti-ADA monoclonal antibody |
Target Antigen | GM-Tg-g-T03661-Ag | ADA VLP (virus-like particle) |
ORF Viral Vector | pGMLP000474 | Human ADA Lentivirus plasmid |
ORF Viral Vector | pGMAP000384 | Human ADA Adenovirus plasmid |
ORF Viral Vector | vGMLP000474 | Human ADA Lentivirus particle |
ORF Viral Vector | vGMAP000384 | Human ADA Adenovirus particle |
Target information
Target ID | GM-T03661 |
Target Name | ADA |
Gene ID | 100, 11486, 717897, 24165, 101090683, 477236, 280712, 100070773 |
Gene Symbol and Synonyms | ADA,ADA-like,ADA1 |
Uniprot Accession | P00813 |
Uniprot Entry Name | ADA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000196839 |
Target Classification | Not Available |
This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine in the purine catabolic pathway. Various mutations have been described for this gene and have been linked to human diseases related to impaired immune function such as severe combined immunodeficiency disease (SCID) which is the result of a deficiency in the ADA enzyme. In ADA-deficient individuals there is a marked depletion of T, B, and NK lymphocytes, and consequently, a lack of both humoral and cellular immunity. Conversely, elevated levels of this enzyme are associated with congenital hemolytic anemia. [provided by RefSeq, Sep 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.