Human TINF2/DKCA3/ TIN2 ORF/cDNA clone-Lentivirus particle (NM_001099274)
Pre-made Human TINF2/DKCA3/ TIN2 Lentiviral expression plasmid for TINF2 lentivirus packaging, TINF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TINF2/DKCA3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000118 | Human TINF2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000118 |
Gene Name | TINF2 |
Accession Number | NM_001099274 |
Gene ID | 26277 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1356 bp |
Gene Alias | DKCA3, TIN2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTACGCCCCTGGTGGCGGGTCCCGCAGCTCTACGCTTCGCCGCCGCGGCTAGCTGGCAGGTTGTGCGCGGACGCTGCGTGGAACATTTTCCGCGAGTACTGGAGTTTCTGCGATCTCTGCGCGCTGTTGCCCCTGGCTTGGTTCGCTACCGGCACCACGAACGCCTTTGTATGGGCCTAAAGGCCAAGGTGGTGGTGGAGCTGATCCTGCAGGGCCGGCCTTGGGCCCAAGTCCTGAAAGCCCTGAATCACCACTTTCCAGAATCTGGACCTATAGTGCGGGATCCCAAGGCTACAAAGCAGGATCTGAGGAAGATTTTGGAGGCACAGGAAACTTTTTACCAGCAGGTGAAGCAGCTGTCAGAGGCTCCTGTGGATTTGGCCTCGAAGCTGCAGGAACTTGAACAAGAGTATGGGGAACCCTTTCTGGCTGCCATGGAAAAGCTGCTTTTTGAGTACTTGTGTCAGCTGGAGAAAGCACTGCCTACACCGCAGGCACAGCAGCTTCAGGATGTGCTGAGTTGGATGCAGCCTGGAGTCTCTATCACCTCTTCTCTTGCCTGGAGACAATATGGTGTGGACATGGGGTGGCTGCTTCCAGAGTGCTCTGTTACTGACTCAGTGAACCTGGCTGAGCCCATGGAACAGAATCCTCCTCAGCAACAAAGACTAGCACTCCACAATCCCCTGCCAAAAGCCAAGCCTGGCACACATCTTCCTCAGGGACCATCTTCAAGGACGCACCCAGAACCTCTAGCTGGCCGACACTTCAATCTGGCCCCTCTAGGCCGACGAAGAGTTCAGTCCCAATGGGCCTCCACTAGGGGAGGCCATAAGGAGCGCCCCACAGTCATGCTGTTTCCCTTTAGGAATCTCGGCTCACCAACCCAGGTCATATCTAAGCCTGAGAGCAAGGAAGAACATGCGATATACACAGCAGACCTAGCCATGGGCACAAGAGCAGCCTCCACTGGGAAGTCTAAGAGTCCATGCCAGACCCTGGGGGGAAGGGCTCTGAAGGAGAACCCAGTTGACTTGCCTGCCACAGAGCAAAAGGAGAATTGCTTGGATTGCTACATGGACCCCCTGAGACTATCATTATTACCTCCTAGGGCCAGGAAGCCAGTGTGTCCTCCGTCTCTGTGCAGCTCCGTCATTACCATAGGGGACTTGGTTTTAGACTCTGATGAGGAAGAAAATGGCCAGGGGGAAGGAAAGGAATCTCTGGAAAACTATCAGAAGACAAAGTTTGACACCTTGATACCCACTCTCTGTGAATACCTACCCCCTTCTGGCCACGGTGCCATACCTGTTTCTTCCTGTGACTGTAGAGACAGTTCTAGACCTTTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1433-Ab | Anti-TINF2/ DKCA3/ TIN2 functional antibody |
Target Antigen | GM-Tg-g-SE1433-Ag | TINF2 protein |
ORF Viral Vector | pGMLP000118 | Human TINF2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000118 | Human TINF2 Lentivirus particle |
Target information
Target ID | GM-SE1433 |
Target Name | TINF2 |
Gene ID | 26277, 28113, 715812, 290232, 101081811, 608377, 540420, 100054625 |
Gene Symbol and Synonyms | D14Wsu146e,DKCA3,TIN2,TINF2 |
Uniprot Accession | Q9BSI4 |
Uniprot Entry Name | TINF2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000092330 |
Target Classification | Not Available |
This gene encodes one of the proteins of the shelterin, or telosome, complex which protects telomeres by allowing the cell to distinguish between telomeres and regions of DNA damage. The protein encoded by this gene is a critical part of shelterin; it interacts with the three DNA-binding proteins of the shelterin complex, and it is important for assembly of the complex. Mutations in this gene cause dyskeratosis congenita (DKC), an inherited bone marrow failure syndrome. [provided by RefSeq, Mar 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.