Human TINF2/DKCA3/ TIN2 ORF/cDNA clone-Lentivirus plasmid (NM_001099274)

Pre-made Human TINF2/DKCA3/ TIN2 Lentiviral expression plasmid for TINF2 lentivirus packaging, TINF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TINF2/DKCA3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000118 Human TINF2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000118
Gene Name TINF2
Accession Number NM_001099274
Gene ID 26277
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1356 bp
Gene Alias DKCA3, TIN2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTACGCCCCTGGTGGCGGGTCCCGCAGCTCTACGCTTCGCCGCCGCGGCTAGCTGGCAGGTTGTGCGCGGACGCTGCGTGGAACATTTTCCGCGAGTACTGGAGTTTCTGCGATCTCTGCGCGCTGTTGCCCCTGGCTTGGTTCGCTACCGGCACCACGAACGCCTTTGTATGGGCCTAAAGGCCAAGGTGGTGGTGGAGCTGATCCTGCAGGGCCGGCCTTGGGCCCAAGTCCTGAAAGCCCTGAATCACCACTTTCCAGAATCTGGACCTATAGTGCGGGATCCCAAGGCTACAAAGCAGGATCTGAGGAAGATTTTGGAGGCACAGGAAACTTTTTACCAGCAGGTGAAGCAGCTGTCAGAGGCTCCTGTGGATTTGGCCTCGAAGCTGCAGGAACTTGAACAAGAGTATGGGGAACCCTTTCTGGCTGCCATGGAAAAGCTGCTTTTTGAGTACTTGTGTCAGCTGGAGAAAGCACTGCCTACACCGCAGGCACAGCAGCTTCAGGATGTGCTGAGTTGGATGCAGCCTGGAGTCTCTATCACCTCTTCTCTTGCCTGGAGACAATATGGTGTGGACATGGGGTGGCTGCTTCCAGAGTGCTCTGTTACTGACTCAGTGAACCTGGCTGAGCCCATGGAACAGAATCCTCCTCAGCAACAAAGACTAGCACTCCACAATCCCCTGCCAAAAGCCAAGCCTGGCACACATCTTCCTCAGGGACCATCTTCAAGGACGCACCCAGAACCTCTAGCTGGCCGACACTTCAATCTGGCCCCTCTAGGCCGACGAAGAGTTCAGTCCCAATGGGCCTCCACTAGGGGAGGCCATAAGGAGCGCCCCACAGTCATGCTGTTTCCCTTTAGGAATCTCGGCTCACCAACCCAGGTCATATCTAAGCCTGAGAGCAAGGAAGAACATGCGATATACACAGCAGACCTAGCCATGGGCACAAGAGCAGCCTCCACTGGGAAGTCTAAGAGTCCATGCCAGACCCTGGGGGGAAGGGCTCTGAAGGAGAACCCAGTTGACTTGCCTGCCACAGAGCAAAAGGAGAATTGCTTGGATTGCTACATGGACCCCCTGAGACTATCATTATTACCTCCTAGGGCCAGGAAGCCAGTGTGTCCTCCGTCTCTGTGCAGCTCCGTCATTACCATAGGGGACTTGGTTTTAGACTCTGATGAGGAAGAAAATGGCCAGGGGGAAGGAAAGGAATCTCTGGAAAACTATCAGAAGACAAAGTTTGACACCTTGATACCCACTCTCTGTGAATACCTACCCCCTTCTGGCCACGGTGCCATACCTGTTTCTTCCTGTGACTGTAGAGACAGTTCTAGACCTTTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1433-Ab Anti-TINF2/ DKCA3/ TIN2 functional antibody
    Target Antigen GM-Tg-g-SE1433-Ag TINF2 protein
    ORF Viral Vector pGMLP000118 Human TINF2 Lentivirus plasmid
    ORF Viral Vector vGMLP000118 Human TINF2 Lentivirus particle


    Target information

    Target ID GM-SE1433
    Target Name TINF2
    Gene ID 26277, 28113, 715812, 290232, 101081811, 608377, 540420, 100054625
    Gene Symbol and Synonyms D14Wsu146e,DKCA3,TIN2,TINF2
    Uniprot Accession Q9BSI4
    Uniprot Entry Name TINF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000092330
    Target Classification Not Available

    This gene encodes one of the proteins of the shelterin, or telosome, complex which protects telomeres by allowing the cell to distinguish between telomeres and regions of DNA damage. The protein encoded by this gene is a critical part of shelterin; it interacts with the three DNA-binding proteins of the shelterin complex, and it is important for assembly of the complex. Mutations in this gene cause dyskeratosis congenita (DKC), an inherited bone marrow failure syndrome. [provided by RefSeq, Mar 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.