Human IL2/IL-2/lymphokine ORF/cDNA clone-Lentivirus particle (NM_000586)

Cat. No.: vGMLP-IL-005

Pre-made Human IL2/IL-2/lymphokine Lentiviral expression plasmid for IL2 lentivirus packaging, IL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IL2/IL-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP-IL-005 Human IL2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP-IL-005
Gene Name IL2
Accession Number NM_000586
Gene ID 3558
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 462 bp
Gene Alias IL-2,lymphokine,TCGF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA
ORF Protein Sequence MYRMQLLSCIALSLALVTNSAPTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTFKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHLRPRDLISNINVIVLELKGSETTFMCEYADETATIVEFLNRWITFCQSIISTLT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-811 Pre-Made Efavaleukin Alfa Biosimilar, Fusion Protein targeting IL2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IL-2/TCGF/lymphokine
    Target Antibody GM-Tg-g-T61698-Ab Anti-IL2/ IL-2/ TCGF functional antibody
    Target Antigen GM-Tg-g-T61698-Ag IL2 protein
    ORF Viral Vector pGMLP000542 Human IL2 Lentivirus plasmid
    ORF Viral Vector pGMAP000406 Human IL2 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-005 Human IL2 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-088 Human IL2 Adenovirus plasmid
    ORF Viral Vector pGMPC004771 Human IL2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000542 Human IL2 Lentivirus particle
    ORF Viral Vector vGMAP000406 Human IL2 Adenovirus particle
    ORF Viral Vector vGMLP-IL-005 Human IL2 Lentivirus particle
    ORF Viral Vector vGMAP-IL-088 Human IL2 Adenovirus particle


    Target information

    Target ID GM-T61698
    Target Name IL2
    Gene ID 3558, 16183, 708017, 116562, 751114, 403989, 280822, 100034204
    Gene Symbol and Synonyms IL-2,IL2,lymphokine,TCGF
    Uniprot Accession P60568
    Uniprot Entry Name IL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Chronic Kidney Disease
    Gene Ensembl ENSG00000109471
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.