Human IL2/IL-2/lymphokine ORF/cDNA clone-Adenovirus particle (BC066257)

Cat. No.: vGMAP000406

Pre-made Human IL2/IL-2/lymphokine Adenovirus for IL2 overexpression in-vitro and in-vivo. The IL2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to IL2/IL-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000406 Human IL2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000406
Gene Name IL2
Accession Number BC066257
Gene ID 3558
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 462 bp
Gene Alias IL-2,lymphokine,TCGF
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA
ORF Protein Sequence MYRMQLLSCIALSLALVTNSAPTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTFKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHLRPRDLISNINVIVLELKGSETTFMCEYADETATIVEFLNRWITFCQSIISTLT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-811 Pre-Made Efavaleukin Alfa Biosimilar, Fusion Protein targeting IL2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IL-2/TCGF/lymphokine
    Target Antibody GM-Tg-g-T61698-Ab Anti-IL2/ IL-2/ TCGF functional antibody
    Target Antigen GM-Tg-g-T61698-Ag IL2 protein
    ORF Viral Vector pGMLP000542 Human IL2 Lentivirus plasmid
    ORF Viral Vector pGMAP000406 Human IL2 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-005 Human IL2 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-088 Human IL2 Adenovirus plasmid
    ORF Viral Vector pGMPC004771 Human IL2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000542 Human IL2 Lentivirus particle
    ORF Viral Vector vGMAP000406 Human IL2 Adenovirus particle
    ORF Viral Vector vGMLP-IL-005 Human IL2 Lentivirus particle
    ORF Viral Vector vGMAP-IL-088 Human IL2 Adenovirus particle


    Target information

    Target ID GM-T61698
    Target Name IL2
    Gene ID 3558, 16183, 708017, 116562, 751114, 403989, 280822, 100034204
    Gene Symbol and Synonyms IL-2,IL2,lymphokine,TCGF
    Uniprot Accession P60568
    Uniprot Entry Name IL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Chronic Kidney Disease
    Gene Ensembl ENSG00000109471
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.