Human IL2/IL-2/lymphokine ORF/cDNA clone-Adenovirus particle (BC066257)
Cat. No.: vGMAP000406
Pre-made Human IL2/IL-2/lymphokine Adenovirus for IL2 overexpression in-vitro and in-vivo. The IL2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IL2/IL-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000406 | Human IL2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000406 |
Gene Name | IL2 |
Accession Number | BC066257 |
Gene ID | 3558 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 462 bp |
Gene Alias | IL-2,lymphokine,TCGF |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA |
ORF Protein Sequence | MYRMQLLSCIALSLALVTNSAPTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTFKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHLRPRDLISNINVIVLELKGSETTFMCEYADETATIVEFLNRWITFCQSIISTLT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-811 | Pre-Made Efavaleukin Alfa Biosimilar, Fusion Protein targeting IL2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IL-2/TCGF/lymphokine |
Target Antibody | GM-Tg-g-T61698-Ab | Anti-IL2/ IL-2/ TCGF functional antibody |
Target Antigen | GM-Tg-g-T61698-Ag | IL2 protein |
ORF Viral Vector | pGMLP000542 | Human IL2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000406 | Human IL2 Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-005 | Human IL2 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-088 | Human IL2 Adenovirus plasmid |
ORF Viral Vector | pGMPC004771 | Human IL2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP000542 | Human IL2 Lentivirus particle |
ORF Viral Vector | vGMAP000406 | Human IL2 Adenovirus particle |
ORF Viral Vector | vGMLP-IL-005 | Human IL2 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-088 | Human IL2 Adenovirus particle |
Target information
Target ID | GM-T61698 |
Target Name | IL2 |
Gene ID | 3558, 16183, 708017, 116562, 751114, 403989, 280822, 100034204 |
Gene Symbol and Synonyms | IL-2,IL2,lymphokine,TCGF |
Uniprot Accession | P60568 |
Uniprot Entry Name | IL2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Chronic Kidney Disease |
Gene Ensembl | ENSG00000109471 |
Target Classification | Checkpoint-Immuno Oncology |
This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.