Human TGFB2/LDS4/TGF-beta2 ORF/cDNA clone-Adenovirus particle (NM_003238.3)
Cat. No.: vGMAP000588
Pre-made Human TGFB2/LDS4/TGF-beta2 Adenovirus for TGFB2 overexpression in-vitro and in-vivo. The TGFB2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TGFB2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
TGFB2/LDS4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000588 | Human TGFB2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000588 |
Gene Name | TGFB2 |
Accession Number | NM_003238.3 |
Gene ID | 7042 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1245 bp |
Gene Alias | LDS4,TGF-beta2 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCACTACTGTGTGCTGAGCGCTTTTCTGATCCTGCATCTGGTCACGGTCGCGCTCAGCCTGTCTACCTGCAGCACACTCGATATGGACCAGTTCATGCGCAAGAGGATCGAGGCGATCCGCGGGCAGATCCTGAGCAAGCTGAAGCTCACCAGTCCCCCAGAAGACTATCCTGAGCCCGAGGAAGTCCCCCCGGAGGTGATTTCCATCTACAACAGCACCAGGGACTTGCTCCAGGAGAAGGCGAGCCGGAGGGCGGCCGCCTGCGAGCGCGAGAGGAGCGACGAAGAGTACTACGCCAAGGAGGTTTACAAAATAGACATGCCGCCCTTCTTCCCCTCCGAAAATGCCATCCCGCCCACTTTCTACAGACCCTACTTCAGAATTGTTCGATTTGACGTCTCAGCAATGGAGAAGAATGCTTCCAATTTGGTGAAAGCAGAGTTCAGAGTCTTTCGTTTGCAGAACCCAAAAGCCAGAGTGCCTGAACAACGGATTGAGCTATATCAGATTCTCAAGTCCAAAGATTTAACATCTCCAACCCAGCGCTACATCGACAGCAAAGTTGTGAAAACAAGAGCAGAAGGCGAATGGCTCTCCTTCGATGTAACTGATGCTGTTCATGAATGGCTTCACCATAAAGACAGGAACCTGGGATTTAAAATAAGCTTACACTGTCCCTGCTGCACTTTTGTACCATCTAATAATTACATCATCCCAAATAAAAGTGAAGAACTAGAAGCAAGATTTGCAGGTATTGATGGCACCTCCACATATACCAGTGGTGATCAGAAAACTATAAAGTCCACTAGGAAAAAAAACAGTGGGAAGACCCCACATCTCCTGCTAATGTTATTGCCCTCCTACAGACTTGAGTCACAACAGACCAACCGGCGGAAGAAGCGTGCTTTGGATGCGGCCTATTGCTTTAGAAATGTGCAGGATAATTGCTGCCTACGTCCACTTTACATTGATTTCAAGAGGGATCTAGGGTGGAAATGGATACACGAACCCAAAGGGTACAATGCCAACTTCTGTGCTGGAGCATGCCCGTATTTATGGAGTTCAGACACTCAGCACAGCAGGGTCCTGAGCTTATATAATACCATAAATCCAGAAGCATCTGCTTCTCCTTGCTGCGTGTCCCAAGATTTAGAACCTCTAACCATTCTCTACTACATTGGCAAAACACCCAAGATTGAACAGCTTTCTAATATGATTGTAAAGTCTTGCAAATGCAGCTAA |
ORF Protein Sequence | MHYCVLSAFLILHLVTVALSLSTCSTLDMDQFMRKRIEAIRGQILSKLKLTSPPEDYPEPEEVPPEVISIYNSTRDLLQEKASRRAAACERERSDEEYYAKEVYKIDMPPFFPSENAIPPTFYRPYFRIVRFDVSAMEKNASNLVKAEFRVFRLQNPKARVPEQRIELYQILKSKDLTSPTQRYIDSKVVKTRAEGEWLSFDVTDAVHEWLHHKDRNLGFKISLHCPCCTFVPSNNYIIPNKSEELEARFAGIDGTSTYTSGDQKTIKSTRKKNSGKTPHLLLMLLPSYRLESQQTNRRKKRALDAAYCFRNVQDNCCLRPLYIDFKRDLGWKWIHEPKGYNANFCAGACPYLWSSDTQHSRVLSLYNTINPEASASPCCVSQDLEPLTILYYIGKTPKIEQLSNMIVKSCKCS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-889 | Pre-Made Lerdelimumab Biosimilar, Whole Mab, Anti-Tgfb2 Antibody: Anti-G-TSF/LDS4/TGF-beta2 therapeutic antibody |
Target Antibody | GM-Tg-g-T14143-Ab | Anti-TGFB2/ G-TSF/ LDS4 functional antibody |
Target Antigen | GM-Tg-g-T14143-Ag | TGFB2 protein |
Cytokine | cks-Tg-g-GM-T14143 | transforming growth factor, beta 2 (TGFB2) protein & antibody |
ORF Viral Vector | pGMLV000388 | Human TGFB2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000588 | Human TGFB2 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-038 | Human TGFB2 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-178 | Human TGFB2 Adenovirus plasmid |
ORF Viral Vector | vGMLV000388 | Human TGFB2 Lentivirus particle |
ORF Viral Vector | vGMAP000588 | Human TGFB2 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-038 | Human TGFB2 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-178 | Human TGFB2 Adenovirus particle |
Target information
Target ID | GM-T14143 |
Target Name | TGFB2 |
Gene ID | 7042, 21808, 707540, 81809, 101093414, 488596, 534069, 100050377 |
Gene Symbol and Synonyms | G-TSF,LDS4,MGF,TGF-B2,TGF-beta2,Tgfb-2,TGFB2,TGFbeta2 |
Uniprot Accession | P61812 |
Uniprot Entry Name | TGFB2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000092969 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.