Human TGFB2/G-TSF/ LDS4 ORF/cDNA clone-Adenovirus plasmid (NM_003238)

Pre-made Human TGFB2/G-TSF/ LDS4 adenoviral expression plasmid for TGFB2 adenovirus packaging, TGFB2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to TGFB2/G-TSF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP-SPh-178 Human TGFB2 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP-SPh-178
Gene Name TGFB2
Accession Number NM_003238
Gene ID 7042
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1245 bp
Gene Alias G-TSF, LDS4, TGF-beta2
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCACTACTGTGTGCTGAGCGCTTTTCTGATCCTGCATCTGGTCACGGTCGCGCTCAGCCTGTCTACCTGCAGCACACTCGATATGGACCAGTTCATGCGCAAGAGGATCGAGGCGATCCGCGGGCAGATCCTGAGCAAGCTGAAGCTCACCAGTCCCCCAGAAGACTATCCTGAGCCCGAGGAAGTCCCCCCGGAGGTGATTTCCATCTACAACAGCACCAGGGACTTGCTCCAGGAGAAGGCGAGCCGGAGGGCGGCCGCCTGCGAGCGCGAGAGGAGCGACGAAGAGTACTACGCCAAGGAGGTTTACAAAATAGACATGCCGCCCTTCTTCCCCTCCGAAAATGCCATCCCGCCCACTTTCTACAGACCCTACTTCAGAATTGTTCGATTTGACGTCTCAGCAATGGAGAAGAATGCTTCCAATTTGGTGAAAGCAGAGTTCAGAGTCTTTCGTTTGCAGAACCCAAAAGCCAGAGTGCCTGAACAACGGATTGAGCTATATCAGATTCTCAAGTCCAAAGATTTAACATCTCCAACCCAGCGCTACATCGACAGCAAAGTTGTGAAAACAAGAGCAGAAGGCGAATGGCTCTCCTTCGATGTAACTGATGCTGTTCATGAATGGCTTCACCATAAAGACAGGAACCTGGGATTTAAAATAAGCTTACACTGTCCCTGCTGCACTTTTGTACCATCTAATAATTACATCATCCCAAATAAAAGTGAAGAACTAGAAGCAAGATTTGCAGGTATTGATGGCACCTCCACATATACCAGTGGTGATCAGAAAACTATAAAGTCCACTAGGAAAAAAAACAGTGGGAAGACCCCACATCTCCTGCTAATGTTATTGCCCTCCTACAGACTTGAGTCACAACAGACCAACCGGCGGAAGAAGCGTGCTTTGGATGCGGCCTATTGCTTTAGAAATGTGCAGGATAATTGCTGCCTACGTCCACTTTACATTGATTTCAAGAGGGATCTAGGGTGGAAATGGATACACGAACCCAAAGGGTACAATGCCAACTTCTGTGCTGGAGCATGCCCGTATTTATGGAGTTCAGACACTCAGCACAGCAGGGTCCTGAGCTTATATAATACCATAAATCCAGAAGCATCTGCTTCTCCTTGCTGCGTGTCCCAAGATTTAGAACCTCTAACCATTCTCTACTACATTGGCAAAACACCCAAGATTGAACAGCTTTCTAATATGATTGTAAAGTCTTGCAAATGCAGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-889 Pre-Made Lerdelimumab Biosimilar, Whole Mab, Anti-Tgfb2 Antibody: Anti-G-TSF/LDS4/TGF-beta2 therapeutic antibody
    Target Antibody GM-Tg-g-T14143-Ab Anti-TGFB2/ G-TSF/ LDS4 functional antibody
    Target Antigen GM-Tg-g-T14143-Ag TGFB2 protein
    Cytokine cks-Tg-g-GM-T14143 transforming growth factor, beta 2 (TGFB2) protein & antibody
    ORF Viral Vector pGMLV000388 Human TGFB2 Lentivirus plasmid
    ORF Viral Vector pGMAP000588 Human TGFB2 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-038 Human TGFB2 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-178 Human TGFB2 Adenovirus plasmid
    ORF Viral Vector vGMLV000388 Human TGFB2 Lentivirus particle
    ORF Viral Vector vGMAP000588 Human TGFB2 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-038 Human TGFB2 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-178 Human TGFB2 Adenovirus particle


    Target information

    Target ID GM-T14143
    Target Name TGFB2
    Gene ID 7042, 21808, 707540, 81809, 101093414, 488596, 534069, 100050377
    Gene Symbol and Synonyms G-TSF,LDS4,MGF,TGF-B2,TGF-beta2,Tgfb-2,TGFB2,TGFbeta2
    Uniprot Accession P61812
    Uniprot Entry Name TGFB2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000092969
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.