Human BMP7/OP-1 ORF/cDNA clone-Adenovirus particle (BC008584)
SKU: vGMAP000439
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human BMP7/OP-1 Adenovirus for BMP7 overexpression in-vitro and in-vivo. The BMP7 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BMP7-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
BMP7/OP-1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000439 | Human BMP7 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000439 |
Gene Name | BMP7 |
Accession Number | BC008584 |
Gene ID | 655 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1296 bp |
Gene Alias | OP-1 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
Sequence | ATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGCTGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCAGGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCGCACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGGCGGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCTCTGGCCAGCCTGCAAGATAGCCATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAGGAATTCTTCCACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCAGAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGACTACATCCGGGAACGCTTCGACAATGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCAGGAGCACTTGGGCAGGGAATCGGATCTCTTCCTGCTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTGGTGTTTGACATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTGGGCCTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCATCAACCCCAAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCAGCCCTTCATGGTGGCTTTCTTCAAGGCCACGGAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCTCCAAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAGCGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATCGCGCCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T50289-Ab | Anti-BMP7/ OP-1 functional antibody |
Target Antigen | GM-Tg-g-T50289-Ag | BMP7 protein |
Cytokine | cks-Tg-g-GM-T50289 | bone morphogenetic protein 7 (BMP7) protein & antibody |
ORF Viral Vector | pGMLV000318 | Human BMP7 Lentivirus plasmid |
ORF Viral Vector | pGMLV000319 | Human BMP7 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000461 | Human BMP7 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000439 | Human BMP7 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-070 | Human BMP7 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-210 | Human BMP7 Adenovirus plasmid |
ORF Viral Vector | vGMLV000318 | Human BMP7 Lentivirus particle |
ORF Viral Vector | vGMLV000319 | Human BMP7 Lentivirus particle |
ORF Viral Vector | vGMAAV000461 | Human BMP7 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000439 | Human BMP7 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-070 | Human BMP7 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-210 | Human BMP7 Adenovirus particle |
Target information
Target ID | GM-T50289 |
Target Name | BMP7 |
Gene ID | 655, 12162, 696948, 85272, 101094168, 477270, 540595, 100050299 |
Gene Symbol and Synonyms | BMP-7,BMP7,OP-1,OP1 |
Uniprot Accession | P18075 |
Uniprot Entry Name | BMP7_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000101144 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone, kidney and brown adipose tissue development. Additionally, this protein induces ectopic bone formation and may promote fracture healing in human patients. [provided by RefSeq, Jul 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.