Human SPARC ORF/cDNA clone-Adenovirus particle (BC004974)
Pre-made Human SPARC/ Adenovirus for SPARC overexpression in-vitro and in-vivo. The SPARC adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SPARC-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to SPARC/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000365 | Human SPARC Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000365 |
Gene Name | SPARC |
Accession Number | BC004974 |
Gene ID | 6678 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 912 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGGCCTGGATCTTCTTTCTCCTTTGCCTGGCCGGGAGGGCCTTGGCAGCCCCTCAGCAAGAAGCCCTGCCTGATGAGACAGAGGTGGTGGAAGAAACTGTGGCAGAGGTGACTGAGGTATCTGTGGGAGCTAATCCTGTCCAGGTGGAAGTAGGAGAATTTGATGATGGTGCAGAGGAAACCGAAGAGGAGGTGGTGGCGGAAAATCCCTGCCAGAACCACCACTGCAAACACGGCAAGGTGTGCGAGCTGGATGAGAACAACACCCCCATGTGCGTGTGCCAGGACCCCACCAGCTGCCCAGCCCCCATTGGCGAGTTTGAGAAGGTGTGCAGCAATGACAACAAGACCTTCGACTCTTCCTGCCACTTCTTTGCCACAAAGTGCACCCTGGAGGGCACCAAGAAGGGCCACAAGCTCCACCTGGACTACATCGGGCCTTGCAAATACATCCCCCCTTGCCTGGACTCTGAGCTGACCGAATTCCCCCTGCGCATGCGGGACTGGCTCAAGAACGTCCTGGTCACCCTGTATGAGAGGGATGAGGACAACAACCTTCTGACTGAGAAGCAGAAGCTGCGGGTGAAGAAGATCCATGAGAATGAGAAGCGCCTGGAGGCAGGAGACCACCCCGTGGAGCTGCTGGCCCGGGACTTCGAGAAGAACTATAACATGTACATCTTCCCTGTACACTGGCAGTTCGGCCAGCTGGACCAGCACCCCATTGACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T09439-Ab | Anti-SPRC/ SPARC/ BM-40 monoclonal antibody |
Target Antigen | GM-Tg-g-T09439-Ag | SPARC VLP (virus-like particle) |
ORF Viral Vector | pGMLV000261 | Human SPARC Lentivirus plasmid |
ORF Viral Vector | pGMAP000365 | Human SPARC Adenovirus plasmid |
ORF Viral Vector | vGMLV000261 | Human SPARC Lentivirus particle |
ORF Viral Vector | vGMAP000365 | Human SPARC Adenovirus particle |
Target information
Target ID | GM-T09439 |
Target Name | SPARC |
Gene ID | 6678, 20692, 712388, 24791, 101099861, 100855736, 282077, 100060119 |
Gene Symbol and Synonyms | BM-40,OI17,ON,ONT,SPARC |
Uniprot Accession | P09486 |
Uniprot Entry Name | SPRC_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000113140 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a cysteine-rich acidic matrix-associated protein. The encoded protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. The gene product has been associated with tumor suppression but has also been correlated with metastasis based on changes to cell shape which can promote tumor cell invasion. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.