Human VDR/NR1I1 ORF/cDNA clone-Adenovirus particle (BC060832)

Cat. No.: vGMAP000353

Pre-made Human VDR/NR1I1 Adenovirus for VDR overexpression in-vitro and in-vivo. The VDR adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified VDR-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to VDR/NR1I1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000353 Human VDR Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000353
Gene Name VDR
Accession Number BC060832
Gene ID 7421
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1284 bp
Gene Alias NR1I1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCAATGGCGGCCAGCACTTCCCTGCCTGACCCTGGAGACTTTGACCGGAACGTGCCCCGGATCTGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACCTGTGAAGGCTGCAAAGGCTTCTTCAGGCGAAGCATGAAGCGGAAGGCACTATTCACCTGCCCCTTCAACGGGGACTGCCGCATCACCAAGGACAACCGACGCCACTGCCAGGCCTGCCGGCTCAAACGCTGTGTGGACATCGGCATGATGAAGGAGTTCATTCTGACAGATGAGGAAGTGCAGAGGAAGCGGGAGATGATCCTGAAGCGGAAGGAGGAGGAGGCCTTGAAGGACAGTCTGCGGCCCAAGCTGTCTGAGGAGCAGCAGCGCATCATTGCCATACTGCTGGACGCCCACCATAAGACCTACGACCCCACCTACTCCGACTTCTGCCAGTTCCGGCCTCCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGCATGTCCTGCTCATGGCCATCTGCATCGTCTCCCCAGATCGTCCTGGGGTGCAGGACGCCGCGCTGATTGAGGCCATCCAGGACCGCCTGTCCAACACACTGCAGACGTACATCCGCTGCCGCCACCCGCCCCCGGGCAGCCACCTGCTCTATGCCAAGATGATCCAGAAGCTAGCCGACCTGCGCAGCCTCAATGAGGAGCACTCCAAGCAGTACCGCTGCCTCTCCTTCCAGCCTGAGTGCAGCATGAAGCTAACGCCCCTTGTGCTCGAAGTGTTTGGCAATGAGATCTCCTGA
ORF Protein Sequence MEAMAASTSLPDPGDFDRNVPRICGVCGDRATGFHFNAMTCEGCKGFFRRSMKRKALFTCPFNGDCRITKDNRRHCQACRLKRCVDIGMMKEFILTDEEVQRKREMILKRKEEEALKDSLRPKLSEEQQRIIAILLDAHHKTYDPTYSDFCQFRPPVRVNDGGGSHPSRPNSRHTPSFSGDSSSSCSDHCITSSDMMDSSSFSNLDLSEEDSDDPSVTLELSQLSMLPHLADLVSYSIQKVIGFAKMIPGFRDLTSEDQIVLLKSSAIEVIMLRSNESFTMDDMSWTCGNQDYKYRVSDVTKAGHSLELIEPLIKFQVGLKKLNLHEEEHVLLMAICIVSPDRPGVQDAALIEAIQDRLSNTLQTYIRCRHPPPGSHLLYAKMIQKLADLRSLNEEHSKQYRCLSFQPECSMKLTPLVLEVFGNEIS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34234-Ab Anti-VDR monoclonal antibody
    Target Antigen GM-Tg-g-T34234-Ag VDR protein
    ORF Viral Vector pGMLV000428 Human VDR Lentivirus plasmid
    ORF Viral Vector pGMAD000853 Human VDR Adenovirus plasmid
    ORF Viral Vector pGMAP000353 Human VDR Adenovirus plasmid
    ORF Viral Vector pGMPC000242 Human VDR Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000428 Human VDR Lentivirus particle
    ORF Viral Vector vGMAD000853 Human VDR Adenovirus particle
    ORF Viral Vector vGMAP000353 Human VDR Adenovirus particle


    Target information

    Target ID GM-T34234
    Target Name VDR
    Gene ID 7421, 22337, 706964, 24873, 100316614, 486588, 533656, 100034072
    Gene Symbol and Synonyms NR1I1,PPP1R163,VDR
    Uniprot Accession P11473
    Uniprot Entry Name VDR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000111424
    Target Classification Not Available

    This gene encodes vitamin D3 receptor, which is a member of the nuclear hormone receptor superfamily of ligand-inducible transcription factors. This receptor also functions as a receptor for the secondary bile acid, lithocholic acid. Downstream targets of vitamin D3 receptor are principally involved in mineral metabolism, though this receptor regulates a variety of other metabolic pathways, such as those involved in immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jun 2018]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.