Human VDR/NR1I1/PPP1R163 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001017535)

Cat. No.: pGMPC000242
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VDR/NR1I1/PPP1R163 Non-Viral expression plasmid (overexpression vector) for mouse VDR overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to VDR/NR1I1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000242
Gene Name VDR
Accession Number NM_001017535
Gene ID 7421
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1284 bp
Gene Alias NR1I1,PPP1R163
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCAATGGCGGCCAGCACTTCCCTGCCTGACCCTGGAGACTTTGACCGGAACGTGCCCCGGATCTGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACCTGTGAAGGCTGCAAAGGCTTCTTCAGGCGAAGCATGAAGCGGAAGGCACTATTCACCTGCCCCTTCAACGGGGACTGCCGCATCACCAAGGACAACCGACGCCACTGCCAGGCCTGCCGGCTCAAACGCTGTGTGGACATCGGCATGATGAAGGAGTTCATTCTGACAGATGAGGAAGTGCAGAGGAAGCGGGAGATGATCCTGAAGCGGAAGGAGGAGGAGGCCTTGAAGGACAGTCTGCGGCCCAAGCTGTCTGAGGAGCAGCAGCGCATCATTGCCATACTGCTGGACGCCCACCATAAGACCTACGACCCCACCTACTCCGACTTCTGCCAGTTCCGGCCTCCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGCATGTCCTGCTCATGGCCATCTGCATCGTCTCCCCAGATCGTCCTGGGGTGCAGGACGCCGCGCTGATTGAGGCCATCCAGGACCGCCTGTCCAACACACTGCAGACGTACATCCGCTGCCGCCACCCGCCCCCGGGCAGCCACCTGCTCTATGCCAAGATGATCCAGAAGCTAGCCGACCTGCGCAGCCTCAATGAGGAGCACTCCAAGCAGTACCGCTGCCTCTCCTTCCAGCCTGAGTGCAGCATGAAGCTAACGCCCCTTGTGCTCGAAGTGTTTGGCAATGAGATCTCCTGA
ORF Protein Sequence MEAMAASTSLPDPGDFDRNVPRICGVCGDRATGFHFNAMTCEGCKGFFRRSMKRKALFTCPFNGDCRITKDNRRHCQACRLKRCVDIGMMKEFILTDEEVQRKREMILKRKEEEALKDSLRPKLSEEQQRIIAILLDAHHKTYDPTYSDFCQFRPPVRVNDGGGSHPSRPNSRHTPSFSGDSSSSCSDHCITSSDMMDSSSFSNLDLSEEDSDDPSVTLELSQLSMLPHLADLVSYSIQKVIGFAKMIPGFRDLTSEDQIVLLKSSAIEVIMLRSNESFTMDDMSWTCGNQDYKYRVSDVTKAGHSLELIEPLIKFQVGLKKLNLHEEEHVLLMAICIVSPDRPGVQDAALIEAIQDRLSNTLQTYIRCRHPPPGSHLLYAKMIQKLADLRSLNEEHSKQYRCLSFQPECSMKLTPLVLEVFGNEIS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34234-Ab Anti-VDR monoclonal antibody
    Target Antigen GM-Tg-g-T34234-Ag VDR protein
    ORF Viral Vector pGMLV000428 Human VDR Lentivirus plasmid
    ORF Viral Vector pGMAD000853 Human VDR Adenovirus plasmid
    ORF Viral Vector pGMAP000353 Human VDR Adenovirus plasmid
    ORF Viral Vector pGMPC000242 Human VDR Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000428 Human VDR Lentivirus particle
    ORF Viral Vector vGMAD000853 Human VDR Adenovirus particle
    ORF Viral Vector vGMAP000353 Human VDR Adenovirus particle


    Target information

    Target ID GM-T34234
    Target Name VDR
    Gene ID 7421, 22337, 706964, 24873, 100316614, 486588, 533656, 100034072
    Gene Symbol and Synonyms NR1I1,PPP1R163,VDR
    Uniprot Accession P11473
    Uniprot Entry Name VDR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000111424
    Target Classification Not Available

    This gene encodes vitamin D3 receptor, which is a member of the nuclear hormone receptor superfamily of ligand-inducible transcription factors. This receptor also functions as a receptor for the secondary bile acid, lithocholic acid. Downstream targets of vitamin D3 receptor are principally involved in mineral metabolism, though this receptor regulates a variety of other metabolic pathways, such as those involved in immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jun 2018]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.