Human DRD2/D2DR/D2R ORF/cDNA clone-Adenovirus particle (BC021195)

Cat. No.: vGMAP000308
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DRD2/D2DR/D2R Adenovirus for DRD2 overexpression in-vitro and in-vivo. The DRD2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DRD2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to D2R/DRD2/D2DR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000308 Human DRD2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000308
Gene Name DRD2
Accession Number BC021195
Gene ID 1813
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1332 bp
Gene Alias D2DR,D2R
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
Sequence ATGGATCCACTGAATCTGTCCTGGTATGATGATGATCTGGAGAGGCAGAACTGGAGCCGGCCCTTCAACGGGTCAGACGGGAAGGCGGACAGACCCCACTACAACTACTATGCCACACTGCTCACCCTGCTCATCGCTGTCATCGTCTTCGGCAACGTGCTGGTGTGCATGGCTGTGTCCCGCGAGAAGGCGCTGCAGACCACCACCAACTACCTGATCGTCAGCCTCGCAGTGGCCGACCTCCTCGTCGCCACACTGGTCATGCCCTGGGTTGTCTACCTGGAGGTGGTAGGTGAGTGGAAATTCAGCAGGATTCACTGTGACATCTTCGTCACTCTGGACGTCATGATGTGCACGGCGAGCATCCTGAACTTGTGTGCCATCAGCATCGACAGGTACACAGCTGTGGCCATGCCCATGCTGTACAATACGCGCTACAGCTCCAAGCGCCGGGTCACCGTCATGATCTCCATCGTCTGGGTCCTGTCCTTCACCATCTCCTGCCCACTCCTCTTCGGACTCAATAACGCAGACCAGAACGAGTGCATCATTGCCAACCCGGCCTTCGTGGTCTACTCCTCCATCGTCTCCTTCTACGTGCCCTTCATTGTCACCCTGCTGGTCTACATCAAGATCTACATTGTCCTCCGCAGACGCCGCAAGCGAGTCAACACCAAACGCAGCAGCCGAGCTTTCAGGGCCCACCTGAGGGCTCCACTAAAGGGCAACTGTACTCACCCCGAGGACATGAAACTCTGCACCGTTATCATGAAGTCTAATGGGAGTTTCCCAGTGAACAGGCGGAGAGTGGAGGCTGCCCGGCGAGCCCAGGAGCTGGAGATGGAGATGCTCTCCAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTCCCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGCATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCGGACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATGCTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACATACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAGCGCCGTGAACCCCATCATCTACACCACCTTCAACATTGAGTTCCGCAAGGCCTTCCTGAAGATCCTCCACTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T67162-Ab Anti-DRD2/ D2R/ D2DR monoclonal antibody
    Target Antigen GM-Tg-g-T67162-Ag D2R/DRD2 VLP (virus-like particle)
    ORF Viral Vector pGMLV000444 Human DRD2 Lentivirus plasmid
    ORF Viral Vector pGMLV000466 Human DRD2 Lentivirus plasmid
    ORF Viral Vector pGMLV000806 Human DRD2 Lentivirus plasmid
    ORF Viral Vector pGMAP000308 Human DRD2 Adenovirus plasmid
    ORF Viral Vector pGMPC001516 Human DRD2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000444 Human DRD2 Lentivirus particle
    ORF Viral Vector vGMLV000466 Human DRD2 Lentivirus particle
    ORF Viral Vector vGMLV000806 Human DRD2 Lentivirus particle
    ORF Viral Vector vGMAP000308 Human DRD2 Adenovirus particle


    Target information

    Target ID GM-T67162
    Target Name D2R
    Gene ID 1813, 13489, 694181, 24318, 101096838, 403701, 281126, 100062195
    Gene Symbol and Synonyms D2DR,D2R,Drd-2,DRD2
    Uniprot Accession P14416
    Uniprot Entry Name DRD2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000149295
    Target Classification GPCR, Tumor-associated antigen (TAA)

    This gene encodes the D2 subtype of the dopamine receptor. This G-protein coupled receptor inhibits adenylyl cyclase activity. A missense mutation in this gene causes myoclonus dystonia; other mutations have been associated with schizophrenia. Alternative splicing of this gene results in two transcript variants encoding different isoforms. A third variant has been described, but it has not been determined whether this form is normal or due to aberrant splicing. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.