Human GJA1/CX43/DFNB38 ORF/cDNA clone-Adenovirus particle (BC026329)

Cat. No.: vGMAP000184

Pre-made Human GJA1/CX43/DFNB38 Adenovirus for GJA1 overexpression in-vitro and in-vivo. The GJA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GJA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to GJA1/CX43 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000184 Human GJA1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000184
Gene Name GJA1
Accession Number BC026329
Gene ID 2697
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1149 bp
Gene Alias CX43,DFNB38
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
ORF Nucleotide Sequence ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCGGTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGTTGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTGCAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATGCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGTGTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAAGAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTCTTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGCTTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTCTCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCCCTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTTAAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGTGGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCTATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAATTACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATGGGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGATAACCAGAATTCAAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGACCAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTGGAGATCTAG
ORF Protein Sequence MGDWSALGKLLDKVQAYSTAGGKVWLSVLFIFRILLLGTAVESAWGDEQSAFRCNTQQPGCENVCYDKSFPISHVRFWVLQIIFVSVPTLLYLAHVFYVMRKEEKLNKKEEELKVAQTDGVNVDMHLKQIEIKKFKYGIEEHGKVKMRGGLLRTYIISILFKSIFEVAFLLIQWYIYGFSLSAVYTCKRDPCPHQVDCFLSRPTEKTIFIIFMLVVSLVSLALNIIELFYVFFKGVKDRVKGKSDPYHATSGALSPAKDCGSQKYAYFNGCSSPTAPLSPMSPPGYKLVTGDRNNSSCRNYNKQASEQNWANYSAEQNRMGQAGSTISNSHAQPFDFPDDNQNSKKLAAGHELQPLAIVDQRPSSRASSRASSRPRPDDLEI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44479-Ab Anti-CXA1/ GJA1/ AVSD3 monoclonal antibody
    Target Antigen GM-Tg-g-T44479-Ag GJA1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001348 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV000455 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV001053 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV001055 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV002512 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMAD001175 Human GJA1 Adenovirus plasmid
    ORF Viral Vector pGMAP000184 Human GJA1 Adenovirus plasmid
    ORF Viral Vector vGMLP001348 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV000455 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV001053 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV001055 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV002512 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMAD001175 Human GJA1 Adenovirus particle
    ORF Viral Vector vGMAP000184 Human GJA1 Adenovirus particle


    Target information

    Target ID GM-T44479
    Target Name GJA1
    Gene ID 2697, 14609, 714344, 24392, 101100211, 403418, 281193, 100067229
    Gene Symbol and Synonyms AVSD3,CMDR,Cnx43,connexin43,CX43,Cx43alpha1,Cxnk1,EKVP,EKVP3,Gja-1,GJA1,GJAL,HLHS1,HSS,Npm1,ODDD,PPKCA
    Uniprot Accession P17302
    Uniprot Entry Name CXA1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000152661
    Target Classification Tumor-associated antigen (TAA)

    This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.